Mutagenetix > Incidental Mutations

Incidental Mutation 'R7698:Cic'

593778

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R7698 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25273172 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 776 (Q776L)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169266
AA Change: Q776L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: Q776L

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169392

SMART Domains

Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	G	1: 37,625,371	E482A	probably benign	Het
A630023A22Rik	C	A	14: 34,052,613	L140F	unknown	Het
Actn1	T	C	12: 80,174,537	T581A	probably benign	Het
AI314180	C	G	4: 58,832,660	C900S	unknown	Het
Ak9	T	C	10: 41,348,076	L495S		Het
Aldh5a1	T	C	13: 24,911,748	D462G	probably damaging	Het
Amz2	A	G	11: 109,429,007	D73G	probably damaging	Het
Ank2	A	G	3: 127,032,211	Y361H	probably benign	Het
Atp8b1	A	G	18: 64,571,022	Y342H	probably benign	Het
Atp8b5	C	T	4: 43,366,735	T833I	probably benign	Het
Camkk2	A	G	5: 122,746,419	I313T	probably damaging	Het
Cdk18	T	C	1: 132,122,378	T20A	probably damaging	Het
Cenpf	A	T	1: 189,662,072	C479S	probably benign	Het
Cfap221	C	A	1: 119,961,929	E192*	probably null	Het
Cfap44	C	T	16: 44,433,786	H958Y	probably damaging	Het
Cldn17	C	A	16: 88,506,356	G162*	probably null	Het
Col19a1	T	A	1: 24,312,078	Y748F	probably benign	Het
Col27a1	C	T	4: 63,225,718	P548S	possibly damaging	Het
Ctsr	T	A	13: 61,162,567	M92L	probably benign	Het
Cyp2d12	T	C	15: 82,558,970	V360A	probably benign	Het
Defa34	G	T	8: 21,666,629	C91F	probably damaging	Het
Dennd2c	G	A	3: 103,165,043	V815I	possibly damaging	Het
Dlgap4	C	T	2: 156,749,095	Q734*	probably null	Het
Dph1	A	T	11: 75,190,441	S7T	probably benign	Het
Dpp8	T	C	9: 65,042,336	V121A	probably benign	Het
Dst	G	A	1: 34,190,387	G2354S	probably benign	Het
Duox2	A	T	2: 122,280,764	L1453Q	probably damaging	Het
Exosc10	T	A	4: 148,558,498	S11T	probably benign	Het
Fetub	A	G	16: 22,939,309	T281A	probably benign	Het
Flii	A	T	11: 60,720,092	W504R	probably damaging	Het
Gm17727	T	C	9: 35,777,176	M38V	probably benign	Het
Gm5093	T	C	17: 46,439,940	R54G	possibly damaging	Het
Gmcl1	T	C	6: 86,707,415	D375G	probably benign	Het
Hikeshi	A	T	7: 89,923,681	N101K	probably benign	Het
Hmcn2	T	C	2: 31,423,153	V3458A	probably damaging	Het
Hspa2	A	G	12: 76,405,309	N259S	possibly damaging	Het
Irf6	T	C	1: 193,161,767	I110T	probably damaging	Het
Kcnj8	T	A	6: 142,565,753	H376L	probably damaging	Het
Kdm6b	G	A	11: 69,405,981	P487S	probably benign	Het
Lcp1	C	A	14: 75,206,211	Y222*	probably null	Het
Manea	T	C	4: 26,327,763	D426G	probably damaging	Het
Map3k20	G	T	2: 72,364,681	E101*	probably null	Het
Map3k20	C	G	2: 72,438,314	S555C	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Myo6	C	T	9: 80,217,656	P6S	unknown	Het
Myoc	A	T	1: 162,639,445	Q61L	probably damaging	Het
N4bp2	T	A	5: 65,808,157	M1183K	probably benign	Het
Olfr1444	T	C	19: 12,862,713	S313P	possibly damaging	Het
Olfr1468-ps1	T	C	19: 13,375,040	F26S	probably damaging	Het
Olfr676	T	A	7: 105,035,907	H236Q	probably benign	Het
Olfr889	T	A	9: 38,115,892	L37*	probably null	Het
Osbpl11	C	G	16: 33,234,447	N633K	probably benign	Het
Pcdhgb5	A	G	18: 37,732,631	E493G	probably damaging	Het
Phf20	T	A	2: 156,294,138	W626R	probably damaging	Het
Pkp2	C	A	16: 16,240,659	Q402K	probably benign	Het
Plch2	C	T	4: 155,002,787	D336N	possibly damaging	Het
Plk1	T	C	7: 122,169,258	F535L	probably damaging	Het
Ppp1r9a	A	T	6: 4,906,430	E328D	probably benign	Het
Prss44	G	A	9: 110,817,311	V369M	probably benign	Het
Rilp	A	G	11: 75,510,972	S193G	probably benign	Het
Rusc2	C	T	4: 43,414,900	Q69*	probably null	Het
Ryr2	T	C	13: 11,761,315	D1112G	possibly damaging	Het
Smc6	A	G	12: 11,283,140	R238G	possibly damaging	Het
Spen	A	G	4: 141,472,845	S2824P	probably damaging	Het
Stk4	T	C	2: 164,083,743	M77T	probably damaging	Het
Syne2	A	T	12: 75,949,064	H2126L	probably damaging	Het
Thsd1	C	T	8: 22,258,987	R625*	probably null	Het
Tle3	A	T	9: 61,412,856	N522I	probably damaging	Het
Tmcc1	C	A	6: 116,043,802	E230*	probably null	Het
Vmn2r90	T	C	17: 17,733,334	S587P	probably benign	Het
Wt1	A	T	2: 105,126,816	Q7L	probably benign	Het
Zfhx2	T	C	14: 55,062,849	I2482V	probably benign	Het
Zfpm2	A	T	15: 41,096,091	I189F	probably benign	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTGTGCCCATTAGCCCTG -3'
(R):5'- TAGCTGCTCGGCACTAGAAC -3'

Sequencing Primer
(F):5'- GAACTGCTGCCCCATCCAG -3'
(R):5'- TCGGCACTAGAACTGGCAAC -3'

Posted On

2019-11-12