Incidental Mutation 'R7698:Mtmr7'
ID593784
Institutional Source Beutler Lab
Gene Symbol Mtmr7
Ensembl Gene ENSMUSG00000039431
Gene Namemyotubularin related protein 7
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7698 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40551095-40634797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40606884 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 62 (A62V)
Ref Sequence ENSEMBL: ENSMUSP00000043851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048890] [ENSMUST00000048898] [ENSMUST00000173957] [ENSMUST00000174205]
Predicted Effect probably benign
Transcript: ENSMUST00000048890
AA Change: A62V

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431
AA Change: A62V

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 4.9e-145 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048898
AA Change: A62V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431
AA Change: A62V

DomainStartEndE-ValueType
Pfam:Myotub-related 109 448 1.6e-143 PFAM
coiled coil region 514 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173957
AA Change: A21V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134020
Gene: ENSMUSG00000039431
AA Change: A21V

DomainStartEndE-ValueType
Pfam:Myotub-related 67 260 4e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174205
AA Change: A62V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431
AA Change: A62V

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 L140F unknown Het
Actn1 T C 12: 80,174,537 T581A probably benign Het
AI314180 C G 4: 58,832,660 C900S unknown Het
Ak9 T C 10: 41,348,076 L495S Het
Aldh5a1 T C 13: 24,911,748 D462G probably damaging Het
Amz2 A G 11: 109,429,007 D73G probably damaging Het
Ank2 A G 3: 127,032,211 Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 Y342H probably benign Het
Atp8b5 C T 4: 43,366,735 T833I probably benign Het
Camkk2 A G 5: 122,746,419 I313T probably damaging Het
Cdk18 T C 1: 132,122,378 T20A probably damaging Het
Cenpf A T 1: 189,662,072 C479S probably benign Het
Cfap221 C A 1: 119,961,929 E192* probably null Het
Cfap44 C T 16: 44,433,786 H958Y probably damaging Het
Cic A T 7: 25,273,172 Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 G162* probably null Het
Col19a1 T A 1: 24,312,078 Y748F probably benign Het
Col27a1 C T 4: 63,225,718 P548S possibly damaging Het
Ctsr T A 13: 61,162,567 M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 V360A probably benign Het
Defa34 G T 8: 21,666,629 C91F probably damaging Het
Dennd2c G A 3: 103,165,043 V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 Q734* probably null Het
Dph1 A T 11: 75,190,441 S7T probably benign Het
Dpp8 T C 9: 65,042,336 V121A probably benign Het
Dst G A 1: 34,190,387 G2354S probably benign Het
Duox2 A T 2: 122,280,764 L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 S11T probably benign Het
Fetub A G 16: 22,939,309 T281A probably benign Het
Flii A T 11: 60,720,092 W504R probably damaging Het
Gm17727 T C 9: 35,777,176 M38V probably benign Het
Gm5093 T C 17: 46,439,940 R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 D375G probably benign Het
Hikeshi A T 7: 89,923,681 N101K probably benign Het
Hmcn2 T C 2: 31,423,153 V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 N259S possibly damaging Het
Irf6 T C 1: 193,161,767 I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 H376L probably damaging Het
Kdm6b G A 11: 69,405,981 P487S probably benign Het
Lcp1 C A 14: 75,206,211 Y222* probably null Het
Manea T C 4: 26,327,763 D426G probably damaging Het
Map3k20 G T 2: 72,364,681 E101* probably null Het
Map3k20 C G 2: 72,438,314 S555C probably benign Het
Myo6 C T 9: 80,217,656 P6S unknown Het
Myoc A T 1: 162,639,445 Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 F26S probably damaging Het
Olfr676 T A 7: 105,035,907 H236Q probably benign Het
Olfr889 T A 9: 38,115,892 L37* probably null Het
Osbpl11 C G 16: 33,234,447 N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 E493G probably damaging Het
Phf20 T A 2: 156,294,138 W626R probably damaging Het
Pkp2 C A 16: 16,240,659 Q402K probably benign Het
Plch2 C T 4: 155,002,787 D336N possibly damaging Het
Plk1 T C 7: 122,169,258 F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 E328D probably benign Het
Prss44 G A 9: 110,817,311 V369M probably benign Het
Rilp A G 11: 75,510,972 S193G probably benign Het
Rusc2 C T 4: 43,414,900 Q69* probably null Het
Ryr2 T C 13: 11,761,315 D1112G possibly damaging Het
Smc6 A G 12: 11,283,140 R238G possibly damaging Het
Spen A G 4: 141,472,845 S2824P probably damaging Het
Stk4 T C 2: 164,083,743 M77T probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 R625* probably null Het
Tle3 A T 9: 61,412,856 N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 E230* probably null Het
Vmn2r90 T C 17: 17,733,334 S587P probably benign Het
Wt1 A T 2: 105,126,816 Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 I2482V probably benign Het
Zfpm2 A T 15: 41,096,091 I189F probably benign Het
Other mutations in Mtmr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Mtmr7 APN 8 40597345 missense probably damaging 1.00
IGL01340:Mtmr7 APN 8 40597422 missense probably damaging 1.00
IGL01773:Mtmr7 APN 8 40581419 missense probably damaging 1.00
IGL02040:Mtmr7 APN 8 40560885 missense probably benign 0.01
IGL02195:Mtmr7 APN 8 40560905 missense probably damaging 0.96
IGL03394:Mtmr7 APN 8 40608929 missense probably damaging 0.97
BB001:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB003:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB011:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB013:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R0116:Mtmr7 UTSW 8 40581405 splice site probably benign
R0379:Mtmr7 UTSW 8 40551601 missense probably damaging 1.00
R1443:Mtmr7 UTSW 8 40560882 missense probably damaging 1.00
R1763:Mtmr7 UTSW 8 40551811 missense probably benign
R4372:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R4482:Mtmr7 UTSW 8 40554384 missense probably benign 0.32
R4502:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R4622:Mtmr7 UTSW 8 40581541 missense probably damaging 1.00
R4833:Mtmr7 UTSW 8 40590462 missense probably damaging 1.00
R4849:Mtmr7 UTSW 8 40608997 missense probably benign 0.00
R4991:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R5424:Mtmr7 UTSW 8 40606830 missense probably benign
R5707:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R5929:Mtmr7 UTSW 8 40558358 critical splice acceptor site probably null
R5985:Mtmr7 UTSW 8 40551832 missense probably benign
R6013:Mtmr7 UTSW 8 40581528 missense probably damaging 1.00
R6249:Mtmr7 UTSW 8 40581482 missense probably damaging 1.00
R7052:Mtmr7 UTSW 8 40555833 missense possibly damaging 0.83
R7249:Mtmr7 UTSW 8 40590477 missense probably benign 0.11
R7538:Mtmr7 UTSW 8 40597384 missense probably damaging 1.00
R7699:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7700:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7708:Mtmr7 UTSW 8 40590511 missense probably damaging 0.98
R7890:Mtmr7 UTSW 8 40551735 missense possibly damaging 0.91
R7924:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7926:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R8059:Mtmr7 UTSW 8 40581522 missense probably damaging 1.00
Z1177:Mtmr7 UTSW 8 40597379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTGCTATTCCTAAGCATAACAG -3'
(R):5'- ACCCTCCAGCTCTTGTAAGC -3'

Sequencing Primer
(F):5'- AACCCTGCCACGTGACTTG -3'
(R):5'- CTCCAGCTCTTGTAAGCAGAGTG -3'
Posted On2019-11-12