Incidental Mutation 'R7698:Zfpm2'
ID 593807
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7698 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41096091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 189 (I189F)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: I189F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I189F

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230319
AA Change: I57F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 L140F unknown Het
Actn1 T C 12: 80,174,537 T581A probably benign Het
AI314180 C G 4: 58,832,660 C900S unknown Het
Ak9 T C 10: 41,348,076 L495S Het
Aldh5a1 T C 13: 24,911,748 D462G probably damaging Het
Amz2 A G 11: 109,429,007 D73G probably damaging Het
Ank2 A G 3: 127,032,211 Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 Y342H probably benign Het
Atp8b5 C T 4: 43,366,735 T833I probably benign Het
Camkk2 A G 5: 122,746,419 I313T probably damaging Het
Cdk18 T C 1: 132,122,378 T20A probably damaging Het
Cenpf A T 1: 189,662,072 C479S probably benign Het
Cfap221 C A 1: 119,961,929 E192* probably null Het
Cfap44 C T 16: 44,433,786 H958Y probably damaging Het
Cic A T 7: 25,273,172 Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 G162* probably null Het
Col19a1 T A 1: 24,312,078 Y748F probably benign Het
Col27a1 C T 4: 63,225,718 P548S possibly damaging Het
Ctsr T A 13: 61,162,567 M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 V360A probably benign Het
Defa34 G T 8: 21,666,629 C91F probably damaging Het
Dennd2c G A 3: 103,165,043 V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 Q734* probably null Het
Dph1 A T 11: 75,190,441 S7T probably benign Het
Dpp8 T C 9: 65,042,336 V121A probably benign Het
Dst G A 1: 34,190,387 G2354S probably benign Het
Duox2 A T 2: 122,280,764 L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 S11T probably benign Het
Fetub A G 16: 22,939,309 T281A probably benign Het
Flii A T 11: 60,720,092 W504R probably damaging Het
Gm17727 T C 9: 35,777,176 M38V probably benign Het
Gm5093 T C 17: 46,439,940 R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 D375G probably benign Het
Hikeshi A T 7: 89,923,681 N101K probably benign Het
Hmcn2 T C 2: 31,423,153 V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 N259S possibly damaging Het
Irf6 T C 1: 193,161,767 I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 H376L probably damaging Het
Kdm6b G A 11: 69,405,981 P487S probably benign Het
Lcp1 C A 14: 75,206,211 Y222* probably null Het
Manea T C 4: 26,327,763 D426G probably damaging Het
Map3k20 G T 2: 72,364,681 E101* probably null Het
Map3k20 C G 2: 72,438,314 S555C probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myo6 C T 9: 80,217,656 P6S unknown Het
Myoc A T 1: 162,639,445 Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 F26S probably damaging Het
Olfr676 T A 7: 105,035,907 H236Q probably benign Het
Olfr889 T A 9: 38,115,892 L37* probably null Het
Osbpl11 C G 16: 33,234,447 N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 E493G probably damaging Het
Phf20 T A 2: 156,294,138 W626R probably damaging Het
Pkp2 C A 16: 16,240,659 Q402K probably benign Het
Plch2 C T 4: 155,002,787 D336N possibly damaging Het
Plk1 T C 7: 122,169,258 F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 E328D probably benign Het
Prss44 G A 9: 110,817,311 V369M probably benign Het
Rilp A G 11: 75,510,972 S193G probably benign Het
Rusc2 C T 4: 43,414,900 Q69* probably null Het
Ryr2 T C 13: 11,761,315 D1112G possibly damaging Het
Smc6 A G 12: 11,283,140 R238G possibly damaging Het
Spen A G 4: 141,472,845 S2824P probably damaging Het
Stk4 T C 2: 164,083,743 M77T probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 R625* probably null Het
Tle3 A T 9: 61,412,856 N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 E230* probably null Het
Vmn2r90 T C 17: 17,733,334 S587P probably benign Het
Wt1 A T 2: 105,126,816 Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 I2482V probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACATTTGTCCACAGAGGCTG -3'
(R):5'- AAGCTGGGCTATTGCACTCAG -3'

Sequencing Primer
(F):5'- GCTGGCTGAGACACACAACTG -3'
(R):5'- GCACTCAGCACTTACTATTGAC -3'
Posted On 2019-11-12