Mutagenetix > Incidental Mutation

Incidental Mutation 'R7698:Zfpm2'

593807

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7698 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41096091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 189 (I189F)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably benign
Transcript: ENSMUST00000053467
AA Change: I189F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I189F

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230319
AA Change: I57F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	G	1: 37,625,371	E482A	probably benign	Het
A630023A22Rik	C	A	14: 34,052,613	L140F	unknown	Het
Actn1	T	C	12: 80,174,537	T581A	probably benign	Het
AI314180	C	G	4: 58,832,660	C900S	unknown	Het
Ak9	T	C	10: 41,348,076	L495S		Het
Aldh5a1	T	C	13: 24,911,748	D462G	probably damaging	Het
Amz2	A	G	11: 109,429,007	D73G	probably damaging	Het
Ank2	A	G	3: 127,032,211	Y361H	probably benign	Het
Atp8b1	A	G	18: 64,571,022	Y342H	probably benign	Het
Atp8b5	C	T	4: 43,366,735	T833I	probably benign	Het
Camkk2	A	G	5: 122,746,419	I313T	probably damaging	Het
Cdk18	T	C	1: 132,122,378	T20A	probably damaging	Het
Cenpf	A	T	1: 189,662,072	C479S	probably benign	Het
Cfap221	C	A	1: 119,961,929	E192*	probably null	Het
Cfap44	C	T	16: 44,433,786	H958Y	probably damaging	Het
Cic	A	T	7: 25,273,172	Q776L	possibly damaging	Het
Cldn17	C	A	16: 88,506,356	G162*	probably null	Het
Col19a1	T	A	1: 24,312,078	Y748F	probably benign	Het
Col27a1	C	T	4: 63,225,718	P548S	possibly damaging	Het
Ctsr	T	A	13: 61,162,567	M92L	probably benign	Het
Cyp2d12	T	C	15: 82,558,970	V360A	probably benign	Het
Defa34	G	T	8: 21,666,629	C91F	probably damaging	Het
Dennd2c	G	A	3: 103,165,043	V815I	possibly damaging	Het
Dlgap4	C	T	2: 156,749,095	Q734*	probably null	Het
Dph1	A	T	11: 75,190,441	S7T	probably benign	Het
Dpp8	T	C	9: 65,042,336	V121A	probably benign	Het
Dst	G	A	1: 34,190,387	G2354S	probably benign	Het
Duox2	A	T	2: 122,280,764	L1453Q	probably damaging	Het
Exosc10	T	A	4: 148,558,498	S11T	probably benign	Het
Fetub	A	G	16: 22,939,309	T281A	probably benign	Het
Flii	A	T	11: 60,720,092	W504R	probably damaging	Het
Gm17727	T	C	9: 35,777,176	M38V	probably benign	Het
Gm5093	T	C	17: 46,439,940	R54G	possibly damaging	Het
Gmcl1	T	C	6: 86,707,415	D375G	probably benign	Het
Hikeshi	A	T	7: 89,923,681	N101K	probably benign	Het
Hmcn2	T	C	2: 31,423,153	V3458A	probably damaging	Het
Hspa2	A	G	12: 76,405,309	N259S	possibly damaging	Het
Irf6	T	C	1: 193,161,767	I110T	probably damaging	Het
Kcnj8	T	A	6: 142,565,753	H376L	probably damaging	Het
Kdm6b	G	A	11: 69,405,981	P487S	probably benign	Het
Lcp1	C	A	14: 75,206,211	Y222*	probably null	Het
Manea	T	C	4: 26,327,763	D426G	probably damaging	Het
Map3k20	G	T	2: 72,364,681	E101*	probably null	Het
Map3k20	C	G	2: 72,438,314	S555C	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Myo6	C	T	9: 80,217,656	P6S	unknown	Het
Myoc	A	T	1: 162,639,445	Q61L	probably damaging	Het
N4bp2	T	A	5: 65,808,157	M1183K	probably benign	Het
Olfr1444	T	C	19: 12,862,713	S313P	possibly damaging	Het
Olfr1468-ps1	T	C	19: 13,375,040	F26S	probably damaging	Het
Olfr676	T	A	7: 105,035,907	H236Q	probably benign	Het
Olfr889	T	A	9: 38,115,892	L37*	probably null	Het
Osbpl11	C	G	16: 33,234,447	N633K	probably benign	Het
Pcdhgb5	A	G	18: 37,732,631	E493G	probably damaging	Het
Phf20	T	A	2: 156,294,138	W626R	probably damaging	Het
Pkp2	C	A	16: 16,240,659	Q402K	probably benign	Het
Plch2	C	T	4: 155,002,787	D336N	possibly damaging	Het
Plk1	T	C	7: 122,169,258	F535L	probably damaging	Het
Ppp1r9a	A	T	6: 4,906,430	E328D	probably benign	Het
Prss44	G	A	9: 110,817,311	V369M	probably benign	Het
Rilp	A	G	11: 75,510,972	S193G	probably benign	Het
Rusc2	C	T	4: 43,414,900	Q69*	probably null	Het
Ryr2	T	C	13: 11,761,315	D1112G	possibly damaging	Het
Smc6	A	G	12: 11,283,140	R238G	possibly damaging	Het
Spen	A	G	4: 141,472,845	S2824P	probably damaging	Het
Stk4	T	C	2: 164,083,743	M77T	probably damaging	Het
Syne2	A	T	12: 75,949,064	H2126L	probably damaging	Het
Thsd1	C	T	8: 22,258,987	R625*	probably null	Het
Tle3	A	T	9: 61,412,856	N522I	probably damaging	Het
Tmcc1	C	A	6: 116,043,802	E230*	probably null	Het
Vmn2r90	T	C	17: 17,733,334	S587P	probably benign	Het
Wt1	A	T	2: 105,126,816	Q7L	probably benign	Het
Zfhx2	T	C	14: 55,062,849	I2482V	probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACATTTGTCCACAGAGGCTG -3'
(R):5'- AAGCTGGGCTATTGCACTCAG -3'

Sequencing Primer
(F):5'- GCTGGCTGAGACACACAACTG -3'
(R):5'- GCACTCAGCACTTACTATTGAC -3'

Posted On

2019-11-12