Incidental Mutation 'R7699:4932438A13Rik'
ID 593833
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene Name RIKEN cDNA 4932438A13 gene
Synonyms Tweek, FSA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 36863104-37053033 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37026154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 267 (S267L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057272
AA Change: S3687L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: S3687L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138152
SMART Domains Protein: ENSMUSP00000117809
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
low complexity region 81 106 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138950
AA Change: S224L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: S224L

DomainStartEndE-ValueType
low complexity region 254 279 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
low complexity region 619 651 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
FSA_C 888 1492 N/A SMART
low complexity region 1495 1506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141740
AA Change: S267L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: S267L

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 298 323 N/A INTRINSIC
low complexity region 397 418 N/A INTRINSIC
low complexity region 500 510 N/A INTRINSIC
low complexity region 522 529 N/A INTRINSIC
low complexity region 605 619 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
low complexity region 698 730 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 940 961 N/A INTRINSIC
FSA_C 967 1571 N/A SMART
low complexity region 1574 1585 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146948
AA Change: S427L

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: S427L

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
low complexity region 458 483 N/A INTRINSIC
low complexity region 557 578 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 747 755 N/A INTRINSIC
low complexity region 823 855 N/A INTRINSIC
low complexity region 878 891 N/A INTRINSIC
low complexity region 1065 1086 N/A INTRINSIC
FSA_C 1092 1696 N/A SMART
low complexity region 1699 1710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152564
AA Change: S3687L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: S3687L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr642 T A 7: 104,050,593 probably benign Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
admonished UTSW 3 36948304 missense probably damaging 1.00
alerted UTSW 3 37033265 missense possibly damaging 0.85
informed UTSW 3 36965849 missense probably damaging 1.00
tipped UTSW 3 36988085 missense possibly damaging 0.81
warned UTSW 3 36965621 missense probably damaging 1.00
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
PIT4515001:4932438A13Rik UTSW 3 36974236 missense probably damaging 1.00
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36987690 splice site probably benign
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36953985 critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36917702 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 splice site probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36931116 missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
R7102:4932438A13Rik UTSW 3 36940798 missense probably damaging 0.99
R7188:4932438A13Rik UTSW 3 36950013 missense probably benign 0.06
R7212:4932438A13Rik UTSW 3 37048009 missense
R7425:4932438A13Rik UTSW 3 36948341 missense probably benign
R7425:4932438A13Rik UTSW 3 36983394 missense probably benign 0.02
R7451:4932438A13Rik UTSW 3 37022807 splice site probably null
R7604:4932438A13Rik UTSW 3 36949843 splice site probably null
R7622:4932438A13Rik UTSW 3 36948413 nonsense probably null
R7671:4932438A13Rik UTSW 3 36943231 missense probably damaging 0.99
R7699:4932438A13Rik UTSW 3 36974172 missense possibly damaging 0.67
R7700:4932438A13Rik UTSW 3 36974172 missense possibly damaging 0.67
R7700:4932438A13Rik UTSW 3 37026154 missense probably benign 0.00
R7748:4932438A13Rik UTSW 3 36959335 critical splice acceptor site probably null
R7767:4932438A13Rik UTSW 3 36920287 critical splice donor site probably null
R7787:4932438A13Rik UTSW 3 36885408 missense probably damaging 1.00
R7830:4932438A13Rik UTSW 3 36964932 frame shift probably null
R7849:4932438A13Rik UTSW 3 37026328 missense
R7912:4932438A13Rik UTSW 3 37007069 missense probably damaging 0.99
R7914:4932438A13Rik UTSW 3 36946283 missense probably benign 0.13
R7945:4932438A13Rik UTSW 3 36965893 missense probably benign 0.03
R8039:4932438A13Rik UTSW 3 36943214 missense probably benign 0.12
R8101:4932438A13Rik UTSW 3 37008502 missense probably damaging 1.00
R8143:4932438A13Rik UTSW 3 36946508 critical splice donor site probably null
R8145:4932438A13Rik UTSW 3 36998267 missense probably damaging 1.00
R8171:4932438A13Rik UTSW 3 36975713 missense probably benign 0.00
R8210:4932438A13Rik UTSW 3 37012881 missense
R8250:4932438A13Rik UTSW 3 36917662 missense probably damaging 0.99
R8369:4932438A13Rik UTSW 3 37011603 missense
R8478:4932438A13Rik UTSW 3 37033277 missense possibly damaging 0.74
R8558:4932438A13Rik UTSW 3 37048601 missense
R8688:4932438A13Rik UTSW 3 37035917 missense
R8724:4932438A13Rik UTSW 3 36890893 missense probably damaging 0.99
R8818:4932438A13Rik UTSW 3 36996548 missense possibly damaging 0.60
R8869:4932438A13Rik UTSW 3 36958858 missense probably damaging 0.99
R8887:4932438A13Rik UTSW 3 37033354 missense possibly damaging 0.95
R8899:4932438A13Rik UTSW 3 36988280 missense probably damaging 1.00
R8907:4932438A13Rik UTSW 3 36948146 nonsense probably null
R8960:4932438A13Rik UTSW 3 37012983 missense probably damaging 1.00
R8990:4932438A13Rik UTSW 3 36921221 missense possibly damaging 0.60
R9021:4932438A13Rik UTSW 3 36998344 missense probably benign 0.00
R9048:4932438A13Rik UTSW 3 37011777 missense
R9100:4932438A13Rik UTSW 3 37044758 missense
R9166:4932438A13Rik UTSW 3 36987367 missense probably damaging 1.00
R9176:4932438A13Rik UTSW 3 36956703 missense possibly damaging 0.82
R9202:4932438A13Rik UTSW 3 36890821 missense probably benign
R9303:4932438A13Rik UTSW 3 37044820 missense
R9305:4932438A13Rik UTSW 3 37044820 missense
R9332:4932438A13Rik UTSW 3 37050840 missense
R9362:4932438A13Rik UTSW 3 36957013 missense probably benign
R9493:4932438A13Rik UTSW 3 37011736 missense
R9534:4932438A13Rik UTSW 3 36998270 missense probably benign 0.01
R9569:4932438A13Rik UTSW 3 37012621 missense
R9593:4932438A13Rik UTSW 3 36947941 missense probably damaging 1.00
RF013:4932438A13Rik UTSW 3 37050757 critical splice acceptor site probably benign
RF015:4932438A13Rik UTSW 3 37050748 critical splice acceptor site probably benign
RF021:4932438A13Rik UTSW 3 37050748 critical splice acceptor site probably benign
RF023:4932438A13Rik UTSW 3 37050760 critical splice acceptor site probably benign
RF034:4932438A13Rik UTSW 3 37050760 critical splice acceptor site probably benign
RF035:4932438A13Rik UTSW 3 37050758 critical splice acceptor site probably benign
RF055:4932438A13Rik UTSW 3 37050757 critical splice acceptor site probably benign
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Z1177:4932438A13Rik UTSW 3 36919950 missense probably benign
Z1177:4932438A13Rik UTSW 3 36983440 missense possibly damaging 0.88
Z1177:4932438A13Rik UTSW 3 37036707 missense
Predicted Primers PCR Primer
(F):5'- AGTGAGGAAATCAACTCAGAGCTTC -3'
(R):5'- AGTAAATGGCTACTCACGAGGG -3'

Sequencing Primer
(F):5'- GAAATCAACTCAGAGCTTCTAAAATG -3'
(R):5'- AAATGGCTACTCACGAGGGTTTCC -3'
Posted On 2019-11-12