Incidental Mutation 'R7699:Mdn1'
ID 593837
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 045760-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32741344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3815 (D3815E)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: D3815E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: D3815E

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: D3815E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: D3815E

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,053 (GRCm38) L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 (GRCm38) H734Q probably benign Het
Acadl A G 1: 66,838,363 (GRCm38) V343A possibly damaging Het
Acot4 A T 12: 84,043,237 (GRCm38) D236V probably damaging Het
App T A 16: 85,040,309 (GRCm38) probably null Het
Arfgef1 G A 1: 10,194,411 (GRCm38) T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 (GRCm38) I814T probably benign Het
Atr A T 9: 95,875,690 (GRCm38) R968* probably null Het
Bltp1 T A 3: 36,974,172 (GRCm38) N2329K possibly damaging Het
Bltp1 C T 3: 37,026,154 (GRCm38) S267L probably benign Het
Capn7 C T 14: 31,352,444 (GRCm38) T268I probably benign Het
Ccn1 C T 3: 145,648,692 (GRCm38) G155R probably damaging Het
Cubn A T 2: 13,348,178 (GRCm38) F1916L probably benign Het
Cubn A G 2: 13,489,917 (GRCm38) V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 (GRCm38) T473S probably damaging Het
Dip2c T G 13: 9,659,311 (GRCm38) S1396A probably benign Het
Dyrk1b T C 7: 28,184,312 (GRCm38) Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 (GRCm38) R206L probably benign Het
Ep400 C T 5: 110,696,032 (GRCm38) R1594Q unknown Het
Fmnl2 G A 2: 53,036,508 (GRCm38) R69Q Het
Fry T A 5: 150,405,327 (GRCm38) H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 (GRCm38) D667E probably benign Het
Gimap7 T A 6: 48,723,857 (GRCm38) Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 (GRCm38) W266R probably damaging Het
Gm28042 T A 2: 120,039,716 (GRCm38) M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 (GRCm38) *231R probably null Het
Gm5592 C A 7: 41,286,407 (GRCm38) A111E probably damaging Het
Gm7694 A G 1: 170,301,148 (GRCm38) *271Q probably null Het
Ift81 T C 5: 122,594,560 (GRCm38) M304V possibly damaging Het
Igfals T C 17: 24,880,574 (GRCm38) L213P probably damaging Het
Ints3 G A 3: 90,421,804 (GRCm38) P83S probably benign Het
Kcna10 T G 3: 107,195,540 (GRCm38) S496A probably damaging Het
Kmt2d G A 15: 98,843,719 (GRCm38) A4520V unknown Het
Lemd3 A T 10: 120,978,090 (GRCm38) Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 (GRCm38) N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 (GRCm38) D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 (GRCm38) M550T possibly damaging Het
Maml2 A T 9: 13,621,089 (GRCm38) Q533L Het
Megf8 C T 7: 25,329,928 (GRCm38) A299V possibly damaging Het
Meis3 G T 7: 16,177,556 (GRCm38) E59D probably benign Het
Mppe1 A G 18: 67,225,704 (GRCm38) *398R probably null Het
Mtmr7 G A 8: 40,606,884 (GRCm38) A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 (GRCm38) T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 (GRCm38) V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 (GRCm38) T53P probably damaging Het
Nrde2 G A 12: 100,130,835 (GRCm38) P902L probably benign Het
Or10ab5 T A 7: 108,645,672 (GRCm38) K301N probably damaging Het
Or11g24 T A 14: 50,425,335 (GRCm38) M272K probably benign Het
Or2y13 A G 11: 49,524,554 (GRCm38) Y277C probably damaging Het
Or51a10 T A 7: 104,050,593 (GRCm38) probably benign Het
Or6c202 T C 10: 129,160,055 (GRCm38) M310V probably benign Het
Pcdha1 A G 18: 36,931,062 (GRCm38) T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 (GRCm38) K98N probably damaging Het
Phrf1 G A 7: 141,254,929 (GRCm38) G207R unknown Het
Pik3r6 A G 11: 68,528,563 (GRCm38) K124R probably damaging Het
Polr2b T A 5: 77,340,421 (GRCm38) F823I probably benign Het
Prss58 T C 6: 40,895,388 (GRCm38) I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 (GRCm38) N766I probably benign Het
Qrfprl T A 6: 65,452,956 (GRCm38) I212N probably benign Het
Repin1 T A 6: 48,597,822 (GRCm38) S562T probably damaging Het
Rgr C T 14: 37,044,595 (GRCm38) D165N probably damaging Het
Rho T C 6: 115,935,239 (GRCm38) F221L probably damaging Het
Rictor C T 15: 6,772,154 (GRCm38) S441L probably benign Het
Rnase2a A G 14: 51,255,791 (GRCm38) I39T probably damaging Het
Rpl13a T G 7: 45,127,236 (GRCm38) I43L probably benign Het
Rpp30 T C 19: 36,089,158 (GRCm38) V97A probably benign Het
Scube3 T C 17: 28,167,049 (GRCm38) Y755H probably damaging Het
Sec24a A T 11: 51,712,257 (GRCm38) V788E probably damaging Het
Spns2 A T 11: 72,489,617 (GRCm38) L60* probably null Het
Strc T C 2: 121,371,748 (GRCm38) N1213S possibly damaging Het
Tec A T 5: 72,786,024 (GRCm38) I116N possibly damaging Het
Tll1 A T 8: 64,093,954 (GRCm38) D319E probably benign Het
Tmem121b T C 6: 120,493,427 (GRCm38) T110A unknown Het
Tmem232 T A 17: 65,265,218 (GRCm38) I593F probably damaging Het
Tpp2 A G 1: 43,970,466 (GRCm38) I487V probably benign Het
Ubr4 C A 4: 139,408,867 (GRCm38) C934* probably null Het
Vmn1r68 A G 7: 10,527,632 (GRCm38) Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 (GRCm38) D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 (GRCm38) W108R possibly damaging Het
Zng1 A G 19: 24,942,681 (GRCm38) probably null Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm38) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm38) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm38) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm38) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm38) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm38) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm38) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm38) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm38) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm38) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm38) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm38) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm38) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm38) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm38) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm38) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm38) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm38) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm38) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm38) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm38) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm38) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm38) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm38) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm38) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm38) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm38) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm38) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm38) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm38) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm38) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm38) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm38) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm38) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm38) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm38) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm38) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm38) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm38) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm38) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm38) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm38) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm38) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm38) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm38) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm38) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm38) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm38) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm38) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm38) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm38) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm38) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm38) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm38) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm38) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm38) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm38) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm38) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm38) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm38) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm38) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm38) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm38) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm38) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm38) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm38) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm38) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm38) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm38) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm38) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm38) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm38) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm38) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm38) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm38) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm38) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm38) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm38) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm38) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm38) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm38) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm38) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm38) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm38) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm38) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm38) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm38) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm38) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm38) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm38) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm38) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm38) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm38) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm38) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm38) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm38) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm38) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm38) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm38) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm38) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm38) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm38) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm38) splice site probably null
R4667:Mdn1 UTSW 4 32,679,572 (GRCm38) missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32,666,430 (GRCm38) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm38) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm38) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm38) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm38) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm38) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm38) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm38) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm38) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm38) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm38) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm38) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm38) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm38) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm38) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm38) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm38) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm38) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm38) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm38) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm38) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm38) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm38) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm38) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm38) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm38) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm38) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm38) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm38) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm38) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm38) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm38) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm38) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm38) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm38) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm38) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm38) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm38) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm38) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm38) missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32,774,041 (GRCm38) missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32,676,786 (GRCm38) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm38) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm38) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm38) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm38) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm38) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm38) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm38) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm38) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm38) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm38) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm38) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm38) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm38) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm38) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm38) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm38) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm38) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm38) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm38) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm38) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm38) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm38) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm38) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm38) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm38) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm38) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm38) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm38) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm38) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm38) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm38) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm38) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm38) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm38) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm38) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm38) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm38) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm38) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm38) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm38) missense probably damaging 1.00
R8708:Mdn1 UTSW 4 32,725,854 (GRCm38) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm38) missense probably damaging 0.97
R8896:Mdn1 UTSW 4 32,678,328 (GRCm38) missense probably benign 0.28
R8918:Mdn1 UTSW 4 32,744,579 (GRCm38) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm38) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm38) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm38) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm38) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm38) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm38) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm38) missense probably benign 0.00
R9226:Mdn1 UTSW 4 32,694,612 (GRCm38) missense probably benign 0.25
R9235:Mdn1 UTSW 4 32,739,122 (GRCm38) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm38) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm38) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm38) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm38) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm38) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm38) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm38) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm38) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm38) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm38) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm38) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm38) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTAAGAGGGTAGCTACAGC -3'
(R):5'- ACACCCACTTAGTTAGTTCCTGG -3'

Sequencing Primer
(F):5'- GGGTAGCTACAGCATGTGC -3'
(R):5'- AGTTCCTGGGTACGCAGAATG -3'
Posted On 2019-11-12