Incidental Mutation 'R7699:Ep400'
ID593844
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7699 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110696032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1594 (R1594Q)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: R1594Q
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: R1594Q

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: R1631Q
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: R1631Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: R1558Q
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: R1558Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125325
SMART Domains Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 107 117 N/A INTRINSIC
low complexity region 223 239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr642 T A 7: 104,050,593 probably benign Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCCCTAATTCAAAGAGCATGTG -3'
(R):5'- TCAGGAGGCAAGGTGCTATATC -3'

Sequencing Primer
(F):5'- CAAAGAGCATGTGCATCTCTG -3'
(R):5'- CAAGGTGCTATATCTTGGCCAG -3'
Posted On2019-11-12