Incidental Mutation 'R7699:Rpl13a'
ID593860
Institutional Source Beutler Lab
Gene Symbol Rpl13a
Ensembl Gene ENSMUSG00000074129
Gene Nameribosomal protein L13A
SynonymsTstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R7699 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45125558-45128761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45127236 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 43 (I43L)
Ref Sequence ENSEMBL: ENSMUSP00000115722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000146760] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209238] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210197] [ENSMUST00000210818] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211429] [ENSMUST00000211725]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146760
SMART Domains Protein: ENSMUSP00000123506
Gene: ENSMUSG00000110206

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Flt3_lig 28 162 1.9e-94 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150350
AA Change: I43L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129
AA Change: I43L

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209212
AA Change: I39L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000209238
Predicted Effect probably benign
Transcript: ENSMUST00000209467
AA Change: I286L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect silent
Transcript: ENSMUST00000209711
Predicted Effect possibly damaging
Transcript: ENSMUST00000209812
AA Change: I43L

PolyPhen 2 Score 0.530 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000209815
AA Change: I39L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000209838
Predicted Effect probably benign
Transcript: ENSMUST00000209927
Predicted Effect probably benign
Transcript: ENSMUST00000210191
AA Change: I43L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000210197
Predicted Effect probably benign
Transcript: ENSMUST00000210818
Predicted Effect probably benign
Transcript: ENSMUST00000210918
AA Change: I43L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000210931
Predicted Effect probably benign
Transcript: ENSMUST00000210967
AA Change: I43L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000211037
AA Change: I39L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000211429
Predicted Effect probably benign
Transcript: ENSMUST00000211725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr642 T A 7: 104,050,593 probably benign Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Rpl13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rpl13a APN 7 45127071 unclassified probably null
R1972:Rpl13a UTSW 7 45125995 nonsense probably null
R1973:Rpl13a UTSW 7 45125995 nonsense probably null
R4501:Rpl13a UTSW 7 45126140 missense probably benign 0.13
R4674:Rpl13a UTSW 7 45126818 unclassified probably benign
R4675:Rpl13a UTSW 7 45126818 unclassified probably benign
R5151:Rpl13a UTSW 7 45125961 missense probably benign 0.35
R7565:Rpl13a UTSW 7 45127042 missense probably benign 0.05
R7667:Rpl13a UTSW 7 45126173 missense probably damaging 0.96
R7700:Rpl13a UTSW 7 45127236 missense probably benign 0.12
Z1088:Rpl13a UTSW 7 45127513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGGTATTCATCCGCTTCCG -3'
(R):5'- GCAACACTCACCATCTTTCG -3'

Sequencing Primer
(F):5'- TTCCGGAGAAAGGCCAGATACTTTAC -3'
(R):5'- GACTGTGAGATCAACCCATGC -3'
Posted On2019-11-12