Mutagenetix > Incidental Mutations

Incidental Mutation 'R7699:Rpl13a'

593860

Institutional Source

Beutler Lab

Gene Symbol

Rpl13a

Ensembl Gene

ENSMUSG00000074129

Gene Name

ribosomal protein L13A

Synonyms

Tstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R7699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45125558-45128761 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 45127236 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 43 (I43L)

Ref Sequence

ENSEMBL: ENSMUSP00000115722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000146760] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209238] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210197] [ENSMUST00000210818] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211429] [ENSMUST00000211725]

Predicted Effect

probably benign
Transcript: ENSMUST00000003521

SMART Domains

Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S17_N	5	73	1.9e-40	PFAM
Pfam:Ribosomal_S17	75	144	1.4e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146760

SMART Domains

Protein: ENSMUSP00000123506
Gene: ENSMUSG00000110206

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Flt3_lig	28	162	1.9e-94	PFAM
transmembrane domain	189	211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150350
AA Change: I43L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129
AA Change: I43L

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L13	6	122	7e-27	PFAM
low complexity region	169	180	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209212
AA Change: I39L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000209238

Predicted Effect

probably benign
Transcript: ENSMUST00000209467
AA Change: I286L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

silent
Transcript: ENSMUST00000209711

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209812
AA Change: I43L

PolyPhen 2 Score 0.530 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000209815
AA Change: I39L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000209838

Predicted Effect

probably benign
Transcript: ENSMUST00000209927

Predicted Effect

probably benign
Transcript: ENSMUST00000210191
AA Change: I43L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000210197

Predicted Effect

probably benign
Transcript: ENSMUST00000210818

Predicted Effect

probably benign
Transcript: ENSMUST00000210918
AA Change: I43L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000210931

Predicted Effect

probably benign
Transcript: ENSMUST00000210967
AA Change: I43L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000211037
AA Change: I39L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000211429

Predicted Effect

probably benign
Transcript: ENSMUST00000211725

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009A15Rik	T	C	19: 8,890,053	L72P	probably benign	Het
4930407I10Rik	C	A	15: 82,064,105	H734Q	probably benign	Het
4932438A13Rik	T	A	3: 36,974,172	N2329K	possibly damaging	Het
4932438A13Rik	C	T	3: 37,026,154	S267L	probably benign	Het
Acadl	A	G	1: 66,838,363	V343A	possibly damaging	Het
Acot4	A	T	12: 84,043,237	D236V	probably damaging	Het
App	T	A	16: 85,040,309		probably null	Het
Arfgef1	G	A	1: 10,194,411	T470I	possibly damaging	Het
Arhgef5	T	C	6: 43,274,757	I814T	probably benign	Het
Atr	A	T	9: 95,875,690	R968*	probably null	Het
C130060K24Rik	T	A	6: 65,452,956	I212N	probably benign	Het
Capn7	C	T	14: 31,352,444	T268I	probably benign	Het
Cbwd1	A	G	19: 24,942,681		probably null	Het
Cubn	A	T	2: 13,348,178	F1916L	probably benign	Het
Cubn	A	G	2: 13,489,917	V107A	possibly damaging	Het
Cyp11b1	T	A	15: 74,835,842	T473S	probably damaging	Het
Cyr61	C	T	3: 145,648,692	G155R	probably damaging	Het
Dip2c	T	G	13: 9,659,311	S1396A	probably benign	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Echdc2	G	T	4: 108,174,077	R206L	probably benign	Het
Ep400	C	T	5: 110,696,032	R1594Q	unknown	Het
Fmnl2	G	A	2: 53,036,508	R69Q		Het
Fry	T	A	5: 150,405,327	H1308Q	probably damaging	Het
Fyb2	T	A	4: 105,010,454	D667E	probably benign	Het
Gimap7	T	A	6: 48,723,857	Y126N	possibly damaging	Het
Gm1979	A	T	5: 26,000,180	W266R	probably damaging	Het
Gm28042	T	A	2: 120,039,716	M712K	possibly damaging	Het
Gm3238	A	G	10: 77,770,635	*231R	probably null	Het
Gm5592	C	A	7: 41,286,407	A111E	probably damaging	Het
Gm7694	A	G	1: 170,301,148	*271Q	probably null	Het
Ift81	T	C	5: 122,594,560	M304V	possibly damaging	Het
Igfals	T	C	17: 24,880,574	L213P	probably damaging	Het
Ints3	G	A	3: 90,421,804	P83S	probably benign	Het
Kcna10	T	G	3: 107,195,540	S496A	probably damaging	Het
Kmt2d	G	A	15: 98,843,719	A4520V	unknown	Het
Lemd3	A	T	10: 120,978,090	Y413N	probably damaging	Het
Lgr6	T	C	1: 134,996,032	N453S	probably damaging	Het
Lmtk3	A	C	7: 45,792,574	D352A	probably damaging	Het
Lrrc4c	T	C	2: 97,630,679	M550T	possibly damaging	Het
Maml2	A	T	9: 13,621,089	Q533L		Het
Mdn1	T	A	4: 32,741,344	D3815E	probably damaging	Het
Megf8	C	T	7: 25,329,928	A299V	possibly damaging	Het
Meis3	G	T	7: 16,177,556	E59D	probably benign	Het
Mppe1	A	G	18: 67,225,704	*398R	probably null	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Mtus1	T	A	8: 41,083,969	T237S	possibly damaging	Het
Ndfip2	T	A	14: 105,287,759	V158E	possibly damaging	Het
Nrbp2	T	G	15: 76,090,897	T53P	probably damaging	Het
Nrde2	G	A	12: 100,130,835	P902L	probably benign	Het
Olfr1383	A	G	11: 49,524,554	Y277C	probably damaging	Het
Olfr509	T	A	7: 108,645,672	K301N	probably damaging	Het
Olfr642	T	A	7: 104,050,593		probably benign	Het
Olfr739	T	A	14: 50,425,335	M272K	probably benign	Het
Olfr771	T	C	10: 129,160,055	M310V	probably benign	Het
Pcdha1	A	G	18: 36,931,062	T260A	probably damaging	Het
Pdlim1	T	G	19: 40,249,658	K98N	probably damaging	Het
Phrf1	G	A	7: 141,254,929	G207R	unknown	Het
Pik3r6	A	G	11: 68,528,563	K124R	probably damaging	Het
Polr2b	T	A	5: 77,340,421	F823I	probably benign	Het
Prss58	T	C	6: 40,895,388	I234V	probably damaging	Het
Ptpn14	A	T	1: 189,865,411	N766I	probably benign	Het
Repin1	T	A	6: 48,597,822	S562T	probably damaging	Het
Rgr	C	T	14: 37,044,595	D165N	probably damaging	Het
Rho	T	C	6: 115,935,239	F221L	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnase2a	A	G	14: 51,255,791	I39T	probably damaging	Het
Rpp30	T	C	19: 36,089,158	V97A	probably benign	Het
Scube3	T	C	17: 28,167,049	Y755H	probably damaging	Het
Sec24a	A	T	11: 51,712,257	V788E	probably damaging	Het
Spns2	A	T	11: 72,489,617	L60*	probably null	Het
Strc	T	C	2: 121,371,748	N1213S	possibly damaging	Het
Tec	A	T	5: 72,786,024	I116N	possibly damaging	Het
Tll1	A	T	8: 64,093,954	D319E	probably benign	Het
Tmem121b	T	C	6: 120,493,427	T110A	unknown	Het
Tmem232	T	A	17: 65,265,218	I593F	probably damaging	Het
Tpp2	A	G	1: 43,970,466	I487V	probably benign	Het
Ubr4	C	A	4: 139,408,867	C934*	probably null	Het
Vmn1r68	A	G	7: 10,527,632	Y180H	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het
Wdr6	A	G	9: 108,576,361	W108R	possibly damaging	Het

Other mutations in Rpl13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Rpl13a	APN	7	45127071	unclassified	probably null
R1972:Rpl13a	UTSW	7	45125995	nonsense	probably null
R1973:Rpl13a	UTSW	7	45125995	nonsense	probably null
R4501:Rpl13a	UTSW	7	45126140	missense	probably benign	0.13
R4674:Rpl13a	UTSW	7	45126818	unclassified	probably benign
R4675:Rpl13a	UTSW	7	45126818	unclassified	probably benign
R5151:Rpl13a	UTSW	7	45125961	missense	probably benign	0.35
R7565:Rpl13a	UTSW	7	45127042	missense	probably benign	0.05
R7667:Rpl13a	UTSW	7	45126173	missense	probably damaging	0.96
R7700:Rpl13a	UTSW	7	45127236	missense	probably benign	0.12
Z1088:Rpl13a	UTSW	7	45127513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGGTATTCATCCGCTTCCG -3'
(R):5'- GCAACACTCACCATCTTTCG -3'

Sequencing Primer
(F):5'- TTCCGGAGAAAGGCCAGATACTTTAC -3'
(R):5'- GACTGTGAGATCAACCCATGC -3'

Posted On

2019-11-12