Incidental Mutation 'R7699:Spns2'
ID593877
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7699 (G1)
Quality Score143.008
Status Not validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 72489617 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 60 (L60*)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303]
Predicted Effect probably null
Transcript: ENSMUST00000045303
AA Change: L60*
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: L60*

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr642 T A 7: 104,050,593 probably benign Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
R8553:Spns2 UTSW 11 72457227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTCCCTAGGGCATCTG -3'
(R):5'- ATGATGTGCCTGGAATGCGC -3'

Sequencing Primer
(F):5'- TCCCTAGGGCATCTGGGATG -3'
(R):5'- CCTGGAATGCGCCTCGG -3'
Posted On2019-11-12