Incidental Mutation 'R7700:Lrrc4c'
ID593910
Institutional Source Beutler Lab
Gene Symbol Lrrc4c
Ensembl Gene ENSMUSG00000050587
Gene Nameleucine rich repeat containing 4C
Synonymsnetrin g1 ligand, 6430556C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7700 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location96318169-97631666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97630679 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 550 (M550T)
Ref Sequence ENSEMBL: ENSMUSP00000131795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059049] [ENSMUST00000135431] [ENSMUST00000162807] [ENSMUST00000170144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059049
AA Change: M550T

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131795
Gene: ENSMUSG00000050587
AA Change: M550T

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135431
AA Change: M550T

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130984
Gene: ENSMUSG00000050587
AA Change: M550T

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162807
AA Change: M550T

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125218
Gene: ENSMUSG00000050587
AA Change: M550T

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170144
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NGL1 is a specific binding partner for netrin G1 (NTNG1; MIM 608818), which is a member of the netrin family of axon guidance molecules (Lin et al., 2003 [PubMed 14595443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice exhibited an increased mean serum IL-6 response to LPS challenge when compared with controls. No other notable phenotype was detected in a high-througput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,563,316 probably null Het
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Csmd2 G T 4: 128,545,756 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dopey2 T G 16: 93,798,761 probably null Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Esyt1 T A 10: 128,515,854 probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Gm9195 A C 14: 72,455,902 probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Pdxk A T 10: 78,443,930 probably null Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Lrrc4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lrrc4c APN 2 97630385 nonsense probably null
IGL02095:Lrrc4c APN 2 97629404 missense probably benign 0.05
IGL02165:Lrrc4c APN 2 97629033 start codon destroyed probably null 0.33
IGL02176:Lrrc4c APN 2 97630253 missense probably damaging 0.96
IGL02674:Lrrc4c APN 2 97629775 missense probably damaging 0.99
IGL03082:Lrrc4c APN 2 97630586 missense probably benign 0.05
IGL03303:Lrrc4c APN 2 97629592 missense probably damaging 1.00
R0946:Lrrc4c UTSW 2 97629464 missense probably benign 0.00
R1037:Lrrc4c UTSW 2 97629985 missense probably benign
R1518:Lrrc4c UTSW 2 97630576 missense probably benign
R1559:Lrrc4c UTSW 2 97630772 missense probably benign 0.00
R2192:Lrrc4c UTSW 2 97629312 missense possibly damaging 0.50
R2213:Lrrc4c UTSW 2 97630471 missense probably benign 0.29
R2279:Lrrc4c UTSW 2 97630505 missense possibly damaging 0.86
R3552:Lrrc4c UTSW 2 97629961 missense probably damaging 1.00
R3840:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R3841:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R4606:Lrrc4c UTSW 2 97630313 missense probably benign 0.22
R4938:Lrrc4c UTSW 2 97629301 missense probably damaging 1.00
R4946:Lrrc4c UTSW 2 97630489 missense probably benign 0.00
R5323:Lrrc4c UTSW 2 97630153 missense probably damaging 1.00
R6014:Lrrc4c UTSW 2 97629212 unclassified probably null
R6297:Lrrc4c UTSW 2 97629619 missense probably damaging 0.99
R6376:Lrrc4c UTSW 2 97629046 missense probably benign 0.03
R7032:Lrrc4c UTSW 2 97629065 missense probably benign
R7419:Lrrc4c UTSW 2 97629761 missense probably benign 0.07
R7699:Lrrc4c UTSW 2 97630679 missense possibly damaging 0.81
R7723:Lrrc4c UTSW 2 97630654 missense possibly damaging 0.91
R7736:Lrrc4c UTSW 2 97630360 missense probably benign 0.02
R7843:Lrrc4c UTSW 2 97630213 missense probably benign 0.19
R7880:Lrrc4c UTSW 2 97630798 missense probably benign 0.08
R8008:Lrrc4c UTSW 2 97630249 missense possibly damaging 0.88
Z1177:Lrrc4c UTSW 2 97630483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACGCCACAGAGCACAAGG -3'
(R):5'- GGATCAATAACGGTTCATGCACTG -3'

Sequencing Primer
(F):5'- CACAGAGCACAAGGTCGACAG -3'
(R):5'- TTCATGCACTGAACTGTGTATTG -3'
Posted On2019-11-12