Incidental Mutation 'R7700:Bltp1'
ID 593914
Institutional Source Beutler Lab
Gene Symbol Bltp1
Ensembl Gene ENSMUSG00000037270
Gene Name bridge-like lipid transfer protein family member 1
Synonyms FSA, 4932438A13Rik, Tweek
MMRRC Submission 045761-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7700 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36917253-37107182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37080303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 267 (S267L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057272
AA Change: S3687L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: S3687L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138152
SMART Domains Protein: ENSMUSP00000117809
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
low complexity region 81 106 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138950
AA Change: S224L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: S224L

DomainStartEndE-ValueType
low complexity region 254 279 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
low complexity region 619 651 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
FSA_C 888 1492 N/A SMART
low complexity region 1495 1506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141740
AA Change: S267L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: S267L

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 298 323 N/A INTRINSIC
low complexity region 397 418 N/A INTRINSIC
low complexity region 500 510 N/A INTRINSIC
low complexity region 522 529 N/A INTRINSIC
low complexity region 605 619 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
low complexity region 698 730 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 940 961 N/A INTRINSIC
FSA_C 967 1571 N/A SMART
low complexity region 1574 1585 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146948
AA Change: S427L

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: S427L

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
low complexity region 458 483 N/A INTRINSIC
low complexity region 557 578 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 747 755 N/A INTRINSIC
low complexity region 823 855 N/A INTRINSIC
low complexity region 878 891 N/A INTRINSIC
low complexity region 1065 1086 N/A INTRINSIC
FSA_C 1092 1696 N/A SMART
low complexity region 1699 1710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152564
AA Change: S3687L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: S3687L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,417 (GRCm39) L72P probably benign Het
4930407I10Rik C A 15: 81,948,306 (GRCm39) H734Q probably benign Het
Acadl A G 1: 66,877,522 (GRCm39) V343A possibly damaging Het
Acot4 A T 12: 84,090,011 (GRCm39) D236V probably damaging Het
App T A 16: 84,837,197 (GRCm39) probably null Het
Arfgef1 G A 1: 10,264,636 (GRCm39) T470I possibly damaging Het
Arhgef5 T C 6: 43,251,691 (GRCm39) I814T probably benign Het
Atr A T 9: 95,757,743 (GRCm39) R968* probably null Het
Capn7 C T 14: 31,074,401 (GRCm39) T268I probably benign Het
Ccdc192 A G 18: 57,696,388 (GRCm39) probably null Het
Ccn1 C T 3: 145,354,447 (GRCm39) G155R probably damaging Het
Csmd2 G T 4: 128,439,549 (GRCm39) probably null Het
Cubn A T 2: 13,352,989 (GRCm39) F1916L probably benign Het
Cubn A G 2: 13,494,728 (GRCm39) V107A possibly damaging Het
Cyp11b1 T A 15: 74,707,691 (GRCm39) T473S probably damaging Het
Dip2c T G 13: 9,709,347 (GRCm39) S1396A probably benign Het
Dop1b T G 16: 93,595,649 (GRCm39) probably null Het
Dyrk1b T C 7: 27,883,737 (GRCm39) Y198H probably damaging Het
Echdc2 G T 4: 108,031,274 (GRCm39) R206L probably benign Het
Ep400 C T 5: 110,843,898 (GRCm39) R1594Q unknown Het
Esyt1 T A 10: 128,351,723 (GRCm39) probably benign Het
Fmnl2 G A 2: 52,926,520 (GRCm39) R69Q Het
Fry T A 5: 150,328,792 (GRCm39) H1308Q probably damaging Het
Fyb2 T A 4: 104,867,651 (GRCm39) D667E probably benign Het
Gimap7 T A 6: 48,700,791 (GRCm39) Y126N possibly damaging Het
Gm1979 A T 5: 26,205,178 (GRCm39) W266R probably damaging Het
Gm28042 T A 2: 119,870,197 (GRCm39) M712K possibly damaging Het
Gm3238 A G 10: 77,606,469 (GRCm39) *231R probably null Het
Gm5592 C A 7: 40,935,831 (GRCm39) A111E probably damaging Het
Gm7694 A G 1: 170,128,717 (GRCm39) *271Q probably null Het
Gm9195 A C 14: 72,693,342 (GRCm39) probably null Het
Ift81 T C 5: 122,732,623 (GRCm39) M304V possibly damaging Het
Igfals T C 17: 25,099,548 (GRCm39) L213P probably damaging Het
Ints3 G A 3: 90,329,111 (GRCm39) P83S probably benign Het
Kcna10 T G 3: 107,102,856 (GRCm39) S496A probably damaging Het
Kmt2d G A 15: 98,741,600 (GRCm39) A4520V unknown Het
Lemd3 A T 10: 120,813,995 (GRCm39) Y413N probably damaging Het
Lgr6 T C 1: 134,923,770 (GRCm39) N453S probably damaging Het
Lmtk3 A C 7: 45,441,998 (GRCm39) D352A probably damaging Het
Lrrc4c T C 2: 97,461,024 (GRCm39) M550T possibly damaging Het
Maml2 A T 9: 13,532,385 (GRCm39) Q533L Het
Mdn1 T A 4: 32,741,344 (GRCm39) D3815E probably damaging Het
Megf8 C T 7: 25,029,353 (GRCm39) A299V possibly damaging Het
Meis3 G T 7: 15,911,481 (GRCm39) E59D probably benign Het
Mppe1 A G 18: 67,358,775 (GRCm39) *398R probably null Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Mtus1 T A 8: 41,537,006 (GRCm39) T237S possibly damaging Het
Ndfip2 T A 14: 105,525,193 (GRCm39) V158E possibly damaging Het
Nrbp2 T G 15: 75,962,746 (GRCm39) T53P probably damaging Het
Nrde2 G A 12: 100,097,094 (GRCm39) P902L probably benign Het
Or10ab5 T A 7: 108,244,879 (GRCm39) K301N probably damaging Het
Or11g24 T A 14: 50,662,792 (GRCm39) M272K probably benign Het
Or2y13 A G 11: 49,415,381 (GRCm39) Y277C probably damaging Het
Or6c202 T C 10: 128,995,924 (GRCm39) M310V probably benign Het
Pcdha1 A G 18: 37,064,115 (GRCm39) T260A probably damaging Het
Pdlim1 T G 19: 40,238,102 (GRCm39) K98N probably damaging Het
Pdxk A T 10: 78,279,764 (GRCm39) probably null Het
Phrf1 G A 7: 140,834,842 (GRCm39) G207R unknown Het
Pik3r6 A G 11: 68,419,389 (GRCm39) K124R probably damaging Het
Polr2b T A 5: 77,488,268 (GRCm39) F823I probably benign Het
Prss58 T C 6: 40,872,322 (GRCm39) I234V probably damaging Het
Ptpn14 A T 1: 189,597,608 (GRCm39) N766I probably benign Het
Qrfprl T A 6: 65,429,940 (GRCm39) I212N probably benign Het
Repin1 T A 6: 48,574,756 (GRCm39) S562T probably damaging Het
Rgr C T 14: 36,766,552 (GRCm39) D165N probably damaging Het
Rho T C 6: 115,912,200 (GRCm39) F221L probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnase2a A G 14: 51,493,248 (GRCm39) I39T probably damaging Het
Rpl13a T G 7: 44,776,660 (GRCm39) I43L probably benign Het
Rpp30 T C 19: 36,066,558 (GRCm39) V97A probably benign Het
Scube3 T C 17: 28,386,023 (GRCm39) Y755H probably damaging Het
Sec24a A T 11: 51,603,084 (GRCm39) V788E probably damaging Het
Spns2 A T 11: 72,380,443 (GRCm39) L60* probably null Het
Strc T C 2: 121,202,229 (GRCm39) N1213S possibly damaging Het
Tec A T 5: 72,943,367 (GRCm39) I116N possibly damaging Het
Tll1 A T 8: 64,546,988 (GRCm39) D319E probably benign Het
Tmem121b T C 6: 120,470,388 (GRCm39) T110A unknown Het
Tmem232 T A 17: 65,572,213 (GRCm39) I593F probably damaging Het
Tpp2 A G 1: 44,009,626 (GRCm39) I487V probably benign Het
Ubr4 C A 4: 139,136,178 (GRCm39) C934* probably null Het
Vmn1r68 A G 7: 10,261,559 (GRCm39) Y180H probably benign Het
Vmn2r25 T C 6: 123,816,882 (GRCm39) D233G possibly damaging Het
Wdr6 A G 9: 108,453,560 (GRCm39) W108R possibly damaging Het
Zng1 A G 19: 24,920,045 (GRCm39) probably null Het
Other mutations in Bltp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Bltp1 APN 3 37,065,876 (GRCm39) missense probably benign 0.00
IGL00434:Bltp1 APN 3 37,041,448 (GRCm39) missense probably damaging 0.98
IGL00640:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00693:Bltp1 APN 3 37,106,696 (GRCm39) utr 3 prime probably benign
IGL00721:Bltp1 APN 3 37,084,900 (GRCm39) splice site probably null
IGL00756:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00896:Bltp1 APN 3 37,093,611 (GRCm39) missense probably benign
IGL00902:Bltp1 APN 3 37,095,494 (GRCm39) missense probably damaging 1.00
IGL00980:Bltp1 APN 3 37,054,190 (GRCm39) missense probably damaging 1.00
IGL01019:Bltp1 APN 3 37,061,133 (GRCm39) critical splice acceptor site probably null
IGL01025:Bltp1 APN 3 37,100,429 (GRCm39) missense possibly damaging 0.89
IGL01306:Bltp1 APN 3 37,059,162 (GRCm39) splice site probably benign
IGL01370:Bltp1 APN 3 37,001,904 (GRCm39) missense probably benign 0.07
IGL01377:Bltp1 APN 3 37,027,601 (GRCm39) critical splice donor site probably null
IGL01401:Bltp1 APN 3 36,996,441 (GRCm39) missense probably benign
IGL01419:Bltp1 APN 3 37,102,270 (GRCm39) missense probably damaging 1.00
IGL01432:Bltp1 APN 3 37,057,908 (GRCm39) missense possibly damaging 0.87
IGL01433:Bltp1 APN 3 36,941,919 (GRCm39) missense probably damaging 1.00
IGL01452:Bltp1 APN 3 37,050,457 (GRCm39) unclassified probably benign
IGL01520:Bltp1 APN 3 37,027,409 (GRCm39) nonsense probably null
IGL01524:Bltp1 APN 3 36,996,531 (GRCm39) missense possibly damaging 0.90
IGL01628:Bltp1 APN 3 37,062,634 (GRCm39) missense probably damaging 1.00
IGL01638:Bltp1 APN 3 37,028,460 (GRCm39) missense probably damaging 1.00
IGL01650:Bltp1 APN 3 37,046,822 (GRCm39) splice site probably benign
IGL01717:Bltp1 APN 3 37,088,885 (GRCm39) missense probably benign
IGL01767:Bltp1 APN 3 37,095,512 (GRCm39) missense probably benign 0.29
IGL01813:Bltp1 APN 3 36,982,669 (GRCm39) missense possibly damaging 0.90
IGL01998:Bltp1 APN 3 37,011,165 (GRCm39) missense possibly damaging 0.49
IGL02172:Bltp1 APN 3 37,059,022 (GRCm39) missense probably damaging 0.99
IGL02197:Bltp1 APN 3 36,960,884 (GRCm39) missense probably damaging 1.00
IGL02248:Bltp1 APN 3 37,023,439 (GRCm39) critical splice donor site probably null
IGL02273:Bltp1 APN 3 36,975,586 (GRCm39) splice site probably benign
IGL02403:Bltp1 APN 3 37,084,813 (GRCm39) missense probably benign
IGL02492:Bltp1 APN 3 37,102,262 (GRCm39) missense probably benign 0.04
IGL02517:Bltp1 APN 3 37,013,017 (GRCm39) missense probably damaging 1.00
IGL02519:Bltp1 APN 3 36,949,464 (GRCm39) missense probably damaging 1.00
IGL02586:Bltp1 APN 3 37,098,757 (GRCm39) nonsense probably null
IGL02620:Bltp1 APN 3 37,090,094 (GRCm39) missense possibly damaging 0.95
IGL02621:Bltp1 APN 3 37,095,633 (GRCm39) splice site probably benign
IGL02670:Bltp1 APN 3 37,021,454 (GRCm39) nonsense probably null
IGL02806:Bltp1 APN 3 37,000,643 (GRCm39) missense possibly damaging 0.95
IGL02985:Bltp1 APN 3 37,012,906 (GRCm39) missense probably damaging 0.99
IGL03004:Bltp1 APN 3 37,019,826 (GRCm39) splice site probably benign
IGL03037:Bltp1 APN 3 37,023,356 (GRCm39) missense probably benign 0.23
IGL03037:Bltp1 APN 3 37,023,357 (GRCm39) missense probably damaging 1.00
IGL03062:Bltp1 APN 3 37,092,666 (GRCm39) splice site probably benign
IGL03137:Bltp1 APN 3 37,088,751 (GRCm39) missense probably damaging 0.98
IGL03150:Bltp1 APN 3 37,002,215 (GRCm39) missense probably damaging 1.00
IGL03204:Bltp1 APN 3 37,105,083 (GRCm39) splice site probably benign
IGL03207:Bltp1 APN 3 37,004,145 (GRCm39) missense possibly damaging 0.73
IGL03256:Bltp1 APN 3 36,960,832 (GRCm39) splice site probably benign
IGL03264:Bltp1 APN 3 37,056,784 (GRCm39) missense probably damaging 1.00
IGL03265:Bltp1 APN 3 37,102,140 (GRCm39) missense probably benign 0.00
IGL03303:Bltp1 APN 3 36,924,226 (GRCm39) missense possibly damaging 0.90
admonished UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
alerted UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
informed UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
resolved UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
tipped UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
warned UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
FR4340:Bltp1 UTSW 3 37,104,901 (GRCm39) critical splice acceptor site probably benign
FR4737:Bltp1 UTSW 3 37,104,903 (GRCm39) critical splice acceptor site probably benign
PIT4515001:Bltp1 UTSW 3 37,028,385 (GRCm39) missense probably damaging 1.00
R0035:Bltp1 UTSW 3 37,041,747 (GRCm39) nonsense probably null
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0092:Bltp1 UTSW 3 37,082,308 (GRCm39) missense probably benign 0.41
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0256:Bltp1 UTSW 3 36,971,922 (GRCm39) missense probably benign 0.01
R0277:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0321:Bltp1 UTSW 3 36,960,937 (GRCm39) splice site probably null
R0323:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0335:Bltp1 UTSW 3 37,023,301 (GRCm39) missense probably damaging 1.00
R0375:Bltp1 UTSW 3 37,100,401 (GRCm39) missense probably damaging 0.99
R0437:Bltp1 UTSW 3 37,043,953 (GRCm39) missense possibly damaging 0.81
R0445:Bltp1 UTSW 3 37,054,214 (GRCm39) missense probably damaging 0.99
R0496:Bltp1 UTSW 3 37,041,784 (GRCm39) missense probably damaging 1.00
R0531:Bltp1 UTSW 3 37,090,974 (GRCm39) missense probably damaging 1.00
R0543:Bltp1 UTSW 3 37,050,607 (GRCm39) missense probably benign 0.22
R0545:Bltp1 UTSW 3 37,041,839 (GRCm39) splice site probably benign
R0674:Bltp1 UTSW 3 37,098,775 (GRCm39) missense possibly damaging 0.86
R0745:Bltp1 UTSW 3 36,982,612 (GRCm39) missense probably damaging 1.00
R0755:Bltp1 UTSW 3 37,000,513 (GRCm39) missense probably damaging 1.00
R0785:Bltp1 UTSW 3 37,013,483 (GRCm39) splice site probably benign
R1056:Bltp1 UTSW 3 37,098,829 (GRCm39) missense probably benign 0.44
R1056:Bltp1 UTSW 3 37,037,602 (GRCm39) missense possibly damaging 0.69
R1080:Bltp1 UTSW 3 37,042,404 (GRCm39) missense probably damaging 1.00
R1103:Bltp1 UTSW 3 37,050,672 (GRCm39) missense probably benign
R1119:Bltp1 UTSW 3 37,041,194 (GRCm39) missense probably damaging 1.00
R1170:Bltp1 UTSW 3 37,098,780 (GRCm39) missense probably damaging 0.98
R1183:Bltp1 UTSW 3 36,949,452 (GRCm39) missense possibly damaging 0.51
R1186:Bltp1 UTSW 3 37,050,461 (GRCm39) unclassified probably benign
R1201:Bltp1 UTSW 3 37,002,524 (GRCm39) missense probably benign
R1219:Bltp1 UTSW 3 37,000,619 (GRCm39) nonsense probably null
R1270:Bltp1 UTSW 3 37,006,333 (GRCm39) missense probably damaging 1.00
R1273:Bltp1 UTSW 3 37,041,359 (GRCm39) missense probably damaging 1.00
R1338:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1364:Bltp1 UTSW 3 37,041,179 (GRCm39) missense probably damaging 1.00
R1437:Bltp1 UTSW 3 36,996,578 (GRCm39) missense possibly damaging 0.65
R1447:Bltp1 UTSW 3 37,019,735 (GRCm39) missense probably damaging 0.98
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1481:Bltp1 UTSW 3 37,062,583 (GRCm39) missense probably damaging 0.99
R1528:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1533:Bltp1 UTSW 3 37,095,524 (GRCm39) missense probably damaging 1.00
R1546:Bltp1 UTSW 3 36,924,205 (GRCm39) missense possibly damaging 0.64
R1606:Bltp1 UTSW 3 36,996,548 (GRCm39) missense probably damaging 1.00
R1638:Bltp1 UTSW 3 37,089,961 (GRCm39) nonsense probably null
R1772:Bltp1 UTSW 3 37,013,581 (GRCm39) missense probably damaging 1.00
R1896:Bltp1 UTSW 3 36,962,380 (GRCm39) nonsense probably null
R1919:Bltp1 UTSW 3 37,061,132 (GRCm39) critical splice acceptor site probably null
R1983:Bltp1 UTSW 3 36,942,014 (GRCm39) missense probably null 1.00
R1987:Bltp1 UTSW 3 37,008,134 (GRCm39) critical splice donor site probably null
R1992:Bltp1 UTSW 3 37,054,181 (GRCm39) missense probably benign 0.32
R1999:Bltp1 UTSW 3 36,962,360 (GRCm39) missense probably damaging 1.00
R2004:Bltp1 UTSW 3 36,949,527 (GRCm39) missense possibly damaging 0.77
R2010:Bltp1 UTSW 3 36,982,700 (GRCm39) missense probably benign 0.09
R2027:Bltp1 UTSW 3 37,102,110 (GRCm39) splice site probably benign
R2039:Bltp1 UTSW 3 37,058,027 (GRCm39) missense possibly damaging 0.66
R2054:Bltp1 UTSW 3 37,002,002 (GRCm39) missense probably benign 0.01
R2089:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,008,119 (GRCm39) missense probably damaging 1.00
R2220:Bltp1 UTSW 3 36,929,679 (GRCm39) critical splice donor site probably null
R2374:Bltp1 UTSW 3 36,939,545 (GRCm39) missense probably benign 0.00
R2437:Bltp1 UTSW 3 37,012,834 (GRCm39) splice site probably null
R2860:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2861:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2909:Bltp1 UTSW 3 37,002,102 (GRCm39) missense probably damaging 1.00
R2925:Bltp1 UTSW 3 37,061,271 (GRCm39) missense probably damaging 0.99
R2940:Bltp1 UTSW 3 37,012,954 (GRCm39) missense probably damaging 1.00
R3015:Bltp1 UTSW 3 36,929,611 (GRCm39) missense probably damaging 1.00
R3086:Bltp1 UTSW 3 37,065,852 (GRCm39) missense possibly damaging 0.56
R3159:Bltp1 UTSW 3 37,013,564 (GRCm39) missense probably benign 0.17
R3440:Bltp1 UTSW 3 37,096,061 (GRCm39) nonsense probably null
R3703:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3705:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3795:Bltp1 UTSW 3 37,084,714 (GRCm39) missense probably benign 0.30
R3820:Bltp1 UTSW 3 37,094,583 (GRCm39) missense probably damaging 1.00
R3862:Bltp1 UTSW 3 36,939,547 (GRCm39) missense possibly damaging 0.73
R3944:Bltp1 UTSW 3 37,084,210 (GRCm39) missense possibly damaging 0.90
R4020:Bltp1 UTSW 3 37,066,724 (GRCm39) intron probably benign
R4091:Bltp1 UTSW 3 37,084,738 (GRCm39) missense probably benign 0.00
R4159:Bltp1 UTSW 3 36,985,232 (GRCm39) missense probably benign 0.00
R4231:Bltp1 UTSW 3 36,974,385 (GRCm39) missense probably benign 0.10
R4368:Bltp1 UTSW 3 37,042,296 (GRCm39) nonsense probably null
R4413:Bltp1 UTSW 3 37,012,830 (GRCm39) splice site probably null
R4475:Bltp1 UTSW 3 37,094,544 (GRCm39) missense probably damaging 1.00
R4488:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4489:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4516:Bltp1 UTSW 3 36,949,460 (GRCm39) missense possibly damaging 0.90
R4580:Bltp1 UTSW 3 37,084,174 (GRCm39) missense probably benign 0.02
R4672:Bltp1 UTSW 3 36,944,139 (GRCm39) makesense probably null
R4705:Bltp1 UTSW 3 37,096,038 (GRCm39) missense probably benign 0.03
R4735:Bltp1 UTSW 3 37,059,116 (GRCm39) missense possibly damaging 0.84
R4741:Bltp1 UTSW 3 36,996,524 (GRCm39) missense probably damaging 0.99
R4754:Bltp1 UTSW 3 37,076,615 (GRCm39) nonsense probably null
R4778:Bltp1 UTSW 3 36,991,214 (GRCm39) missense possibly damaging 0.90
R4833:Bltp1 UTSW 3 37,019,117 (GRCm39) missense probably damaging 0.96
R4896:Bltp1 UTSW 3 37,020,086 (GRCm39) missense probably damaging 1.00
R4910:Bltp1 UTSW 3 37,052,348 (GRCm39) missense probably damaging 1.00
R4922:Bltp1 UTSW 3 37,041,314 (GRCm39) missense probably damaging 1.00
R4941:Bltp1 UTSW 3 36,974,050 (GRCm39) missense probably benign 0.41
R4941:Bltp1 UTSW 3 36,971,851 (GRCm39) missense probably damaging 1.00
R4980:Bltp1 UTSW 3 36,997,461 (GRCm39) missense probably damaging 1.00
R5030:Bltp1 UTSW 3 36,997,548 (GRCm39) intron probably benign
R5049:Bltp1 UTSW 3 37,095,539 (GRCm39) missense probably damaging 1.00
R5049:Bltp1 UTSW 3 37,094,655 (GRCm39) intron probably benign
R5089:Bltp1 UTSW 3 37,041,651 (GRCm39) missense probably benign 0.02
R5092:Bltp1 UTSW 3 37,054,234 (GRCm39) missense probably benign 0.14
R5122:Bltp1 UTSW 3 37,088,906 (GRCm39) splice site probably null
R5210:Bltp1 UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
R5246:Bltp1 UTSW 3 37,102,199 (GRCm39) missense probably damaging 1.00
R5289:Bltp1 UTSW 3 37,054,258 (GRCm39) missense probably damaging 0.97
R5348:Bltp1 UTSW 3 37,102,295 (GRCm39) missense probably damaging 1.00
R5394:Bltp1 UTSW 3 36,971,817 (GRCm39) missense probably damaging 1.00
R5434:Bltp1 UTSW 3 36,929,665 (GRCm39) missense probably damaging 1.00
R5667:Bltp1 UTSW 3 36,971,826 (GRCm39) missense probably benign 0.00
R5686:Bltp1 UTSW 3 36,971,809 (GRCm39) missense probably benign 0.00
R5701:Bltp1 UTSW 3 36,975,509 (GRCm39) missense probably benign 0.10
R5778:Bltp1 UTSW 3 37,012,863 (GRCm39) missense probably damaging 1.00
R5787:Bltp1 UTSW 3 37,046,882 (GRCm39) splice site probably null
R5800:Bltp1 UTSW 3 37,106,592 (GRCm39) missense probably damaging 1.00
R5819:Bltp1 UTSW 3 37,102,749 (GRCm39) missense probably benign 0.12
R5820:Bltp1 UTSW 3 37,093,675 (GRCm39) missense probably benign 0.00
R5952:Bltp1 UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
R5975:Bltp1 UTSW 3 37,023,370 (GRCm39) missense possibly damaging 0.64
R5996:Bltp1 UTSW 3 36,985,265 (GRCm39) missense probably benign 0.07
R6192:Bltp1 UTSW 3 37,042,318 (GRCm39) missense probably benign 0.00
R6225:Bltp1 UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
R6234:Bltp1 UTSW 3 37,037,620 (GRCm39) missense probably benign 0.00
R6244:Bltp1 UTSW 3 37,011,148 (GRCm39) missense probably benign
R6263:Bltp1 UTSW 3 36,985,260 (GRCm39) missense probably benign 0.06
R6351:Bltp1 UTSW 3 36,962,377 (GRCm39) missense probably damaging 1.00
R6380:Bltp1 UTSW 3 37,087,456 (GRCm39) missense probably benign 0.19
R6468:Bltp1 UTSW 3 37,062,592 (GRCm39) missense probably damaging 1.00
R6759:Bltp1 UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
R6792:Bltp1 UTSW 3 37,065,715 (GRCm39) critical splice acceptor site probably null
R6809:Bltp1 UTSW 3 36,928,431 (GRCm39) missense probably damaging 0.98
R6841:Bltp1 UTSW 3 37,075,630 (GRCm39) missense probably damaging 1.00
R6959:Bltp1 UTSW 3 37,021,338 (GRCm39) missense probably damaging 1.00
R7102:Bltp1 UTSW 3 36,994,947 (GRCm39) missense probably damaging 0.99
R7188:Bltp1 UTSW 3 37,004,162 (GRCm39) missense probably benign 0.06
R7212:Bltp1 UTSW 3 37,102,158 (GRCm39) missense
R7425:Bltp1 UTSW 3 37,037,543 (GRCm39) missense probably benign 0.02
R7425:Bltp1 UTSW 3 37,002,490 (GRCm39) missense probably benign
R7451:Bltp1 UTSW 3 37,076,956 (GRCm39) splice site probably null
R7604:Bltp1 UTSW 3 37,003,992 (GRCm39) splice site probably null
R7622:Bltp1 UTSW 3 37,002,562 (GRCm39) nonsense probably null
R7671:Bltp1 UTSW 3 36,997,380 (GRCm39) missense probably damaging 0.99
R7699:Bltp1 UTSW 3 37,080,303 (GRCm39) missense probably benign 0.00
R7699:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7700:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7748:Bltp1 UTSW 3 37,013,484 (GRCm39) critical splice acceptor site probably null
R7767:Bltp1 UTSW 3 36,974,436 (GRCm39) critical splice donor site probably null
R7787:Bltp1 UTSW 3 36,939,557 (GRCm39) missense probably damaging 1.00
R7830:Bltp1 UTSW 3 37,019,081 (GRCm39) frame shift probably null
R7849:Bltp1 UTSW 3 37,080,477 (GRCm39) missense
R7912:Bltp1 UTSW 3 37,061,218 (GRCm39) missense probably damaging 0.99
R7914:Bltp1 UTSW 3 37,000,432 (GRCm39) missense probably benign 0.13
R7945:Bltp1 UTSW 3 37,020,042 (GRCm39) missense probably benign 0.03
R8039:Bltp1 UTSW 3 36,997,363 (GRCm39) missense probably benign 0.12
R8101:Bltp1 UTSW 3 37,062,651 (GRCm39) missense probably damaging 1.00
R8143:Bltp1 UTSW 3 37,000,657 (GRCm39) critical splice donor site probably null
R8145:Bltp1 UTSW 3 37,052,416 (GRCm39) missense probably damaging 1.00
R8171:Bltp1 UTSW 3 37,029,862 (GRCm39) missense probably benign 0.00
R8210:Bltp1 UTSW 3 37,067,030 (GRCm39) missense
R8250:Bltp1 UTSW 3 36,971,811 (GRCm39) missense probably damaging 0.99
R8369:Bltp1 UTSW 3 37,065,752 (GRCm39) missense
R8478:Bltp1 UTSW 3 37,087,426 (GRCm39) missense possibly damaging 0.74
R8558:Bltp1 UTSW 3 37,102,750 (GRCm39) missense
R8688:Bltp1 UTSW 3 37,090,066 (GRCm39) missense
R8724:Bltp1 UTSW 3 36,945,042 (GRCm39) missense probably damaging 0.99
R8818:Bltp1 UTSW 3 37,050,697 (GRCm39) missense possibly damaging 0.60
R8869:Bltp1 UTSW 3 37,013,007 (GRCm39) missense probably damaging 0.99
R8887:Bltp1 UTSW 3 37,087,503 (GRCm39) missense possibly damaging 0.95
R8899:Bltp1 UTSW 3 37,042,429 (GRCm39) missense probably damaging 1.00
R8907:Bltp1 UTSW 3 37,002,295 (GRCm39) nonsense probably null
R8960:Bltp1 UTSW 3 37,067,132 (GRCm39) missense probably damaging 1.00
R8990:Bltp1 UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
R9021:Bltp1 UTSW 3 37,052,493 (GRCm39) missense probably benign 0.00
R9048:Bltp1 UTSW 3 37,065,926 (GRCm39) missense
R9100:Bltp1 UTSW 3 37,098,907 (GRCm39) missense
R9166:Bltp1 UTSW 3 37,041,516 (GRCm39) missense probably damaging 1.00
R9176:Bltp1 UTSW 3 37,010,852 (GRCm39) missense possibly damaging 0.82
R9202:Bltp1 UTSW 3 36,944,970 (GRCm39) missense probably benign
R9303:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9305:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9332:Bltp1 UTSW 3 37,104,989 (GRCm39) missense
R9362:Bltp1 UTSW 3 37,011,162 (GRCm39) missense probably benign
R9493:Bltp1 UTSW 3 37,065,885 (GRCm39) missense
R9534:Bltp1 UTSW 3 37,052,419 (GRCm39) missense probably benign 0.01
R9569:Bltp1 UTSW 3 37,066,770 (GRCm39) missense
R9593:Bltp1 UTSW 3 37,002,090 (GRCm39) missense probably damaging 1.00
R9600:Bltp1 UTSW 3 37,095,565 (GRCm39) nonsense probably null
R9733:Bltp1 UTSW 3 37,102,732 (GRCm39) missense
R9751:Bltp1 UTSW 3 37,065,889 (GRCm39) missense
RF013:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
RF015:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF021:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF023:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF034:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF035:Bltp1 UTSW 3 37,104,907 (GRCm39) critical splice acceptor site probably benign
RF055:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
X0050:Bltp1 UTSW 3 37,011,277 (GRCm39) missense probably damaging 1.00
Z1088:Bltp1 UTSW 3 37,041,716 (GRCm39) missense probably damaging 1.00
Z1177:Bltp1 UTSW 3 37,037,589 (GRCm39) missense possibly damaging 0.88
Z1177:Bltp1 UTSW 3 36,974,099 (GRCm39) missense probably benign
Z1177:Bltp1 UTSW 3 37,090,856 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTCACAGTGAGGAAATCAACTCAG -3'
(R):5'- TGGCTACTCACGAGGGTTTC -3'

Sequencing Primer
(F):5'- TGAGGAAATCAACTCAGAGCTTC -3'
(R):5'- CTCACGAGGGTTTCCTGTAAATATAG -3'
Posted On 2019-11-12