Incidental Mutation 'R7700:Tec'
ID593923
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7700 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72786024 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 116 (I116N)
Ref Sequence ENSEMBL: ENSMUSP00000071836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071944
AA Change: I116N

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: I116N

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073843
AA Change: I116N

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: I116N

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113594
AA Change: I116N

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: I116N

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126481
AA Change: I116N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217
AA Change: I116N

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149533
SMART Domains Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Meta Mutation Damage Score 0.2143 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,563,316 probably null Het
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Csmd2 G T 4: 128,545,756 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dopey2 T G 16: 93,798,761 probably null Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Esyt1 T A 10: 128,515,854 probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Gm9195 A C 14: 72,455,902 probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Pdxk A T 10: 78,443,930 probably null Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
development UTSW 5 72782177 critical splice acceptor site probably null
technocrat UTSW 5 72782012 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
PIT4696001:Tec UTSW 5 72773835 missense possibly damaging 0.73
R0254:Tec UTSW 5 72763556 splice site probably benign
R0254:Tec UTSW 5 72783738 missense probably benign 0.12
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R1617:Tec UTSW 5 72782105 missense probably damaging 0.97
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4389:Tec UTSW 5 72782007 missense probably benign
R4507:Tec UTSW 5 72760358 missense probably damaging 1.00
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R5595:Tec UTSW 5 72768744 missense possibly damaging 0.91
R7211:Tec UTSW 5 72782012 missense probably null 0.98
R7404:Tec UTSW 5 72763618 missense probably damaging 1.00
R7465:Tec UTSW 5 72773880 missense probably damaging 1.00
R7526:Tec UTSW 5 72786019 missense probably benign
R7548:Tec UTSW 5 72760350 missense probably damaging 1.00
R7699:Tec UTSW 5 72786024 missense possibly damaging 0.60
R8021:Tec UTSW 5 72757469 missense probably benign 0.03
R8217:Tec UTSW 5 72764259 missense probably benign 0.13
Z1177:Tec UTSW 5 72768707 missense probably damaging 1.00
Z1177:Tec UTSW 5 72782015 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTGTATCTGCCCTGTAGTG -3'
(R):5'- GAGAACCATCTAGCTGCTCTG -3'

Sequencing Primer
(F):5'- GTATCTGCCCTGTAGTGTCCTC -3'
(R):5'- GAACCATCTAGCTGCTCTGAATATTG -3'
Posted On2019-11-12