Incidental Mutation 'R7700:Polr2b'
ID593924
Institutional Source Beutler Lab
Gene Symbol Polr2b
Ensembl Gene ENSMUSG00000029250
Gene Namepolymerase (RNA) II (DNA directed) polypeptide B
SynonymsRPB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7700 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location77310147-77349324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77340421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 823 (F823I)
Ref Sequence ENSEMBL: ENSMUSP00000031167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
AA Change: F823I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: F823I

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,563,316 probably null Het
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Csmd2 G T 4: 128,545,756 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dopey2 T G 16: 93,798,761 probably null Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Esyt1 T A 10: 128,515,854 probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Gm9195 A C 14: 72,455,902 probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Pdxk A T 10: 78,443,930 probably null Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Polr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Polr2b APN 5 77332252 missense probably benign
IGL02069:Polr2b APN 5 77343197 missense probably benign 0.01
IGL03218:Polr2b APN 5 77315917 missense probably benign 0.03
R0007:Polr2b UTSW 5 77340437 missense probably benign 0.02
R0056:Polr2b UTSW 5 77334535 missense possibly damaging 0.55
R0076:Polr2b UTSW 5 77326561 missense possibly damaging 0.78
R0099:Polr2b UTSW 5 77320950 splice site probably benign
R0114:Polr2b UTSW 5 77343263 missense probably damaging 1.00
R0193:Polr2b UTSW 5 77320076 missense probably damaging 1.00
R0481:Polr2b UTSW 5 77332082 missense possibly damaging 0.90
R0607:Polr2b UTSW 5 77313159 unclassified probably benign
R1233:Polr2b UTSW 5 77334565 missense probably benign
R1597:Polr2b UTSW 5 77326101 missense probably damaging 1.00
R1674:Polr2b UTSW 5 77326623 missense possibly damaging 0.83
R1696:Polr2b UTSW 5 77342648 missense probably benign 0.12
R1704:Polr2b UTSW 5 77342560 missense possibly damaging 0.95
R1871:Polr2b UTSW 5 77326527 splice site probably benign
R2114:Polr2b UTSW 5 77320970 missense probably damaging 1.00
R2137:Polr2b UTSW 5 77320346 missense probably benign 0.18
R2305:Polr2b UTSW 5 77320437 splice site probably benign
R3921:Polr2b UTSW 5 77326653 missense probably damaging 1.00
R4027:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4031:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4526:Polr2b UTSW 5 77326714 missense probably damaging 1.00
R4750:Polr2b UTSW 5 77332039 missense possibly damaging 0.92
R4827:Polr2b UTSW 5 77342551 missense probably benign
R5244:Polr2b UTSW 5 77343000 intron probably benign
R5360:Polr2b UTSW 5 77349146 missense possibly damaging 0.90
R5628:Polr2b UTSW 5 77313216 missense probably damaging 0.98
R5928:Polr2b UTSW 5 77345342 missense probably damaging 1.00
R6009:Polr2b UTSW 5 77320252 missense probably benign
R6179:Polr2b UTSW 5 77320977 missense probably damaging 1.00
R6251:Polr2b UTSW 5 77348294 missense probably benign 0.00
R7209:Polr2b UTSW 5 77343179 missense probably damaging 1.00
R7303:Polr2b UTSW 5 77321021 missense probably benign 0.04
R7328:Polr2b UTSW 5 77315999 missense probably damaging 1.00
R7345:Polr2b UTSW 5 77349119 missense possibly damaging 0.55
R7471:Polr2b UTSW 5 77321066 nonsense probably null
R7581:Polr2b UTSW 5 77326704 missense probably damaging 1.00
R7697:Polr2b UTSW 5 77320212 missense probably damaging 1.00
R7699:Polr2b UTSW 5 77340421 missense probably benign 0.00
R7956:Polr2b UTSW 5 77320245 missense probably benign 0.35
R7995:Polr2b UTSW 5 77325767 missense possibly damaging 0.96
R8015:Polr2b UTSW 5 77336506 missense probably damaging 1.00
R8247:Polr2b UTSW 5 77320215 missense possibly damaging 0.94
R8318:Polr2b UTSW 5 77335729 missense probably benign 0.00
X0054:Polr2b UTSW 5 77348305 missense probably damaging 0.97
Z1088:Polr2b UTSW 5 77342722 missense possibly damaging 0.95
Z1088:Polr2b UTSW 5 77345401 missense probably damaging 1.00
Z1176:Polr2b UTSW 5 77331971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGTGACCCTTGTGCCTG -3'
(R):5'- CCCTTAAGTCTGAGCTCTAAGAG -3'

Sequencing Primer
(F):5'- CATAGTGACCCTTGTGCCTGTTTTG -3'
(R):5'- CTTGGCTAAAGGACATGCTGACC -3'
Posted On2019-11-12