Incidental Mutation 'R7700:Ep400'
ID 593925
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms mDomino, 1700020J09Rik, p400
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7700 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110664373-110770717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110696032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1594 (R1594Q)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: R1594Q
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: R1594Q

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: R1631Q
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: R1631Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: R1558Q
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: R1558Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125325
SMART Domains Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 107 117 N/A INTRINSIC
low complexity region 223 239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,563,316 probably null Het
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Csmd2 G T 4: 128,545,756 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dopey2 T G 16: 93,798,761 probably null Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Esyt1 T A 10: 128,515,854 probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Gm9195 A C 14: 72,455,902 probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Meis3 G T 7: 16,177,556 E59D probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Pdxk A T 10: 78,443,930 probably null Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 splice site probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 splice site probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7856:Ep400 UTSW 5 110666584 missense probably damaging 0.99
R7954:Ep400 UTSW 5 110668733 missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110693251 missense unknown
R8108:Ep400 UTSW 5 110687883 missense unknown
R8260:Ep400 UTSW 5 110755612 nonsense probably null
R8293:Ep400 UTSW 5 110708892 missense unknown
R8314:Ep400 UTSW 5 110755753 missense unknown
R8351:Ep400 UTSW 5 110739334 missense probably damaging 1.00
R8424:Ep400 UTSW 5 110693278 missense unknown
R8459:Ep400 UTSW 5 110708891 missense unknown
R8529:Ep400 UTSW 5 110719236 missense unknown
R8688:Ep400 UTSW 5 110720819 missense unknown
R8744:Ep400 UTSW 5 110742059 missense unknown
R8923:Ep400 UTSW 5 110683998 missense unknown
R9005:Ep400 UTSW 5 110711093 missense unknown
R9087:Ep400 UTSW 5 110667564 nonsense probably null
R9146:Ep400 UTSW 5 110701769 nonsense probably null
R9383:Ep400 UTSW 5 110685485 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Z1176:Ep400 UTSW 5 110756635 missense unknown
Z1177:Ep400 UTSW 5 110683364 missense unknown
Z1177:Ep400 UTSW 5 110733743 missense unknown
Z1188:Ep400 UTSW 5 110755683 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCCCTAATTCAAAGAGCATGTG -3'
(R):5'- TCAGGAGGCAAGGTGCTATATC -3'

Sequencing Primer
(F):5'- CAAAGAGCATGTGCATCTCTG -3'
(R):5'- CAAGGTGCTATATCTTGGCCAG -3'
Posted On 2019-11-12