Incidental Mutation 'R7700:Prss58'
ID 593928
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Name serine protease 58
Synonyms BC048599
MMRRC Submission 045761-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R7700 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40872204-40877321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40872322 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 234 (I234V)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523] [ENSMUST00000103262]
AlphaFold Q8BW11
Predicted Effect probably damaging
Transcript: ENSMUST00000063523
AA Change: I234V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: I234V

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103262
SMART Domains Protein: ENSMUSP00000100078
Gene: ENSMUSG00000076461

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:V-set 22 116 8.4e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,417 (GRCm39) L72P probably benign Het
4930407I10Rik C A 15: 81,948,306 (GRCm39) H734Q probably benign Het
Acadl A G 1: 66,877,522 (GRCm39) V343A possibly damaging Het
Acot4 A T 12: 84,090,011 (GRCm39) D236V probably damaging Het
App T A 16: 84,837,197 (GRCm39) probably null Het
Arfgef1 G A 1: 10,264,636 (GRCm39) T470I possibly damaging Het
Arhgef5 T C 6: 43,251,691 (GRCm39) I814T probably benign Het
Atr A T 9: 95,757,743 (GRCm39) R968* probably null Het
Bltp1 T A 3: 37,028,321 (GRCm39) N2329K possibly damaging Het
Bltp1 C T 3: 37,080,303 (GRCm39) S267L probably benign Het
Capn7 C T 14: 31,074,401 (GRCm39) T268I probably benign Het
Ccdc192 A G 18: 57,696,388 (GRCm39) probably null Het
Ccn1 C T 3: 145,354,447 (GRCm39) G155R probably damaging Het
Csmd2 G T 4: 128,439,549 (GRCm39) probably null Het
Cubn A T 2: 13,352,989 (GRCm39) F1916L probably benign Het
Cubn A G 2: 13,494,728 (GRCm39) V107A possibly damaging Het
Cyp11b1 T A 15: 74,707,691 (GRCm39) T473S probably damaging Het
Dip2c T G 13: 9,709,347 (GRCm39) S1396A probably benign Het
Dop1b T G 16: 93,595,649 (GRCm39) probably null Het
Dyrk1b T C 7: 27,883,737 (GRCm39) Y198H probably damaging Het
Echdc2 G T 4: 108,031,274 (GRCm39) R206L probably benign Het
Ep400 C T 5: 110,843,898 (GRCm39) R1594Q unknown Het
Esyt1 T A 10: 128,351,723 (GRCm39) probably benign Het
Fmnl2 G A 2: 52,926,520 (GRCm39) R69Q Het
Fry T A 5: 150,328,792 (GRCm39) H1308Q probably damaging Het
Fyb2 T A 4: 104,867,651 (GRCm39) D667E probably benign Het
Gimap7 T A 6: 48,700,791 (GRCm39) Y126N possibly damaging Het
Gm1979 A T 5: 26,205,178 (GRCm39) W266R probably damaging Het
Gm28042 T A 2: 119,870,197 (GRCm39) M712K possibly damaging Het
Gm3238 A G 10: 77,606,469 (GRCm39) *231R probably null Het
Gm5592 C A 7: 40,935,831 (GRCm39) A111E probably damaging Het
Gm7694 A G 1: 170,128,717 (GRCm39) *271Q probably null Het
Gm9195 A C 14: 72,693,342 (GRCm39) probably null Het
Ift81 T C 5: 122,732,623 (GRCm39) M304V possibly damaging Het
Igfals T C 17: 25,099,548 (GRCm39) L213P probably damaging Het
Ints3 G A 3: 90,329,111 (GRCm39) P83S probably benign Het
Kcna10 T G 3: 107,102,856 (GRCm39) S496A probably damaging Het
Kmt2d G A 15: 98,741,600 (GRCm39) A4520V unknown Het
Lemd3 A T 10: 120,813,995 (GRCm39) Y413N probably damaging Het
Lgr6 T C 1: 134,923,770 (GRCm39) N453S probably damaging Het
Lmtk3 A C 7: 45,441,998 (GRCm39) D352A probably damaging Het
Lrrc4c T C 2: 97,461,024 (GRCm39) M550T possibly damaging Het
Maml2 A T 9: 13,532,385 (GRCm39) Q533L Het
Mdn1 T A 4: 32,741,344 (GRCm39) D3815E probably damaging Het
Megf8 C T 7: 25,029,353 (GRCm39) A299V possibly damaging Het
Meis3 G T 7: 15,911,481 (GRCm39) E59D probably benign Het
Mppe1 A G 18: 67,358,775 (GRCm39) *398R probably null Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Mtus1 T A 8: 41,537,006 (GRCm39) T237S possibly damaging Het
Ndfip2 T A 14: 105,525,193 (GRCm39) V158E possibly damaging Het
Nrbp2 T G 15: 75,962,746 (GRCm39) T53P probably damaging Het
Nrde2 G A 12: 100,097,094 (GRCm39) P902L probably benign Het
Or10ab5 T A 7: 108,244,879 (GRCm39) K301N probably damaging Het
Or11g24 T A 14: 50,662,792 (GRCm39) M272K probably benign Het
Or2y13 A G 11: 49,415,381 (GRCm39) Y277C probably damaging Het
Or6c202 T C 10: 128,995,924 (GRCm39) M310V probably benign Het
Pcdha1 A G 18: 37,064,115 (GRCm39) T260A probably damaging Het
Pdlim1 T G 19: 40,238,102 (GRCm39) K98N probably damaging Het
Pdxk A T 10: 78,279,764 (GRCm39) probably null Het
Phrf1 G A 7: 140,834,842 (GRCm39) G207R unknown Het
Pik3r6 A G 11: 68,419,389 (GRCm39) K124R probably damaging Het
Polr2b T A 5: 77,488,268 (GRCm39) F823I probably benign Het
Ptpn14 A T 1: 189,597,608 (GRCm39) N766I probably benign Het
Qrfprl T A 6: 65,429,940 (GRCm39) I212N probably benign Het
Repin1 T A 6: 48,574,756 (GRCm39) S562T probably damaging Het
Rgr C T 14: 36,766,552 (GRCm39) D165N probably damaging Het
Rho T C 6: 115,912,200 (GRCm39) F221L probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnase2a A G 14: 51,493,248 (GRCm39) I39T probably damaging Het
Rpl13a T G 7: 44,776,660 (GRCm39) I43L probably benign Het
Rpp30 T C 19: 36,066,558 (GRCm39) V97A probably benign Het
Scube3 T C 17: 28,386,023 (GRCm39) Y755H probably damaging Het
Sec24a A T 11: 51,603,084 (GRCm39) V788E probably damaging Het
Spns2 A T 11: 72,380,443 (GRCm39) L60* probably null Het
Strc T C 2: 121,202,229 (GRCm39) N1213S possibly damaging Het
Tec A T 5: 72,943,367 (GRCm39) I116N possibly damaging Het
Tll1 A T 8: 64,546,988 (GRCm39) D319E probably benign Het
Tmem121b T C 6: 120,470,388 (GRCm39) T110A unknown Het
Tmem232 T A 17: 65,572,213 (GRCm39) I593F probably damaging Het
Tpp2 A G 1: 44,009,626 (GRCm39) I487V probably benign Het
Ubr4 C A 4: 139,136,178 (GRCm39) C934* probably null Het
Vmn1r68 A G 7: 10,261,559 (GRCm39) Y180H probably benign Het
Vmn2r25 T C 6: 123,816,882 (GRCm39) D233G possibly damaging Het
Wdr6 A G 9: 108,453,560 (GRCm39) W108R possibly damaging Het
Zng1 A G 19: 24,920,045 (GRCm39) probably null Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40,872,399 (GRCm39) missense probably damaging 1.00
IGL01108:Prss58 APN 6 40,874,278 (GRCm39) missense probably damaging 1.00
IGL01645:Prss58 APN 6 40,874,244 (GRCm39) missense probably damaging 0.98
R0032:Prss58 UTSW 6 40,872,633 (GRCm39) missense probably benign 0.00
R0032:Prss58 UTSW 6 40,872,633 (GRCm39) missense probably benign 0.00
R1622:Prss58 UTSW 6 40,874,248 (GRCm39) missense possibly damaging 0.84
R2511:Prss58 UTSW 6 40,874,734 (GRCm39) missense probably damaging 1.00
R4292:Prss58 UTSW 6 40,874,244 (GRCm39) missense probably damaging 0.98
R5093:Prss58 UTSW 6 40,874,751 (GRCm39) missense probably damaging 1.00
R5601:Prss58 UTSW 6 40,874,783 (GRCm39) missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40,874,703 (GRCm39) missense probably damaging 1.00
R6806:Prss58 UTSW 6 40,874,666 (GRCm39) missense probably damaging 0.98
R7105:Prss58 UTSW 6 40,874,700 (GRCm39) missense probably damaging 1.00
R7136:Prss58 UTSW 6 40,876,987 (GRCm39) critical splice donor site probably null
R7344:Prss58 UTSW 6 40,872,399 (GRCm39) missense probably damaging 1.00
R7699:Prss58 UTSW 6 40,872,322 (GRCm39) missense probably damaging 1.00
R7954:Prss58 UTSW 6 40,872,543 (GRCm39) missense possibly damaging 0.92
R8305:Prss58 UTSW 6 40,872,594 (GRCm39) missense probably benign 0.00
R8370:Prss58 UTSW 6 40,872,358 (GRCm39) missense probably damaging 1.00
R9488:Prss58 UTSW 6 40,874,382 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTTCCCATTCTCTGAGACAG -3'
(R):5'- TAATGGACTCTTAATGCCCTCC -3'

Sequencing Primer
(F):5'- AGGGAGAAAGGGTTGTATGTGTG -3'
(R):5'- AATGGACTCTTAATGCCCTCCTTTCC -3'
Posted On 2019-11-12