Incidental Mutation 'R7700:Repin1'
ID 593930
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Name replication initiator 1
Synonyms Zfp464, AP4, E430037F08Rik
MMRRC Submission 045761-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7700 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48570817-48576016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48574756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 562 (S562T)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
AlphaFold Q5U4E2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009420
AA Change: S506T

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: S506T

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118229
AA Change: S559T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: S559T

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135151
AA Change: S562T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: S562T

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154010
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163452
AA Change: S506T

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: S506T

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,417 (GRCm39) L72P probably benign Het
4930407I10Rik C A 15: 81,948,306 (GRCm39) H734Q probably benign Het
Acadl A G 1: 66,877,522 (GRCm39) V343A possibly damaging Het
Acot4 A T 12: 84,090,011 (GRCm39) D236V probably damaging Het
App T A 16: 84,837,197 (GRCm39) probably null Het
Arfgef1 G A 1: 10,264,636 (GRCm39) T470I possibly damaging Het
Arhgef5 T C 6: 43,251,691 (GRCm39) I814T probably benign Het
Atr A T 9: 95,757,743 (GRCm39) R968* probably null Het
Bltp1 T A 3: 37,028,321 (GRCm39) N2329K possibly damaging Het
Bltp1 C T 3: 37,080,303 (GRCm39) S267L probably benign Het
Capn7 C T 14: 31,074,401 (GRCm39) T268I probably benign Het
Ccdc192 A G 18: 57,696,388 (GRCm39) probably null Het
Ccn1 C T 3: 145,354,447 (GRCm39) G155R probably damaging Het
Csmd2 G T 4: 128,439,549 (GRCm39) probably null Het
Cubn A T 2: 13,352,989 (GRCm39) F1916L probably benign Het
Cubn A G 2: 13,494,728 (GRCm39) V107A possibly damaging Het
Cyp11b1 T A 15: 74,707,691 (GRCm39) T473S probably damaging Het
Dip2c T G 13: 9,709,347 (GRCm39) S1396A probably benign Het
Dop1b T G 16: 93,595,649 (GRCm39) probably null Het
Dyrk1b T C 7: 27,883,737 (GRCm39) Y198H probably damaging Het
Echdc2 G T 4: 108,031,274 (GRCm39) R206L probably benign Het
Ep400 C T 5: 110,843,898 (GRCm39) R1594Q unknown Het
Esyt1 T A 10: 128,351,723 (GRCm39) probably benign Het
Fmnl2 G A 2: 52,926,520 (GRCm39) R69Q Het
Fry T A 5: 150,328,792 (GRCm39) H1308Q probably damaging Het
Fyb2 T A 4: 104,867,651 (GRCm39) D667E probably benign Het
Gimap7 T A 6: 48,700,791 (GRCm39) Y126N possibly damaging Het
Gm1979 A T 5: 26,205,178 (GRCm39) W266R probably damaging Het
Gm28042 T A 2: 119,870,197 (GRCm39) M712K possibly damaging Het
Gm3238 A G 10: 77,606,469 (GRCm39) *231R probably null Het
Gm5592 C A 7: 40,935,831 (GRCm39) A111E probably damaging Het
Gm7694 A G 1: 170,128,717 (GRCm39) *271Q probably null Het
Gm9195 A C 14: 72,693,342 (GRCm39) probably null Het
Ift81 T C 5: 122,732,623 (GRCm39) M304V possibly damaging Het
Igfals T C 17: 25,099,548 (GRCm39) L213P probably damaging Het
Ints3 G A 3: 90,329,111 (GRCm39) P83S probably benign Het
Kcna10 T G 3: 107,102,856 (GRCm39) S496A probably damaging Het
Kmt2d G A 15: 98,741,600 (GRCm39) A4520V unknown Het
Lemd3 A T 10: 120,813,995 (GRCm39) Y413N probably damaging Het
Lgr6 T C 1: 134,923,770 (GRCm39) N453S probably damaging Het
Lmtk3 A C 7: 45,441,998 (GRCm39) D352A probably damaging Het
Lrrc4c T C 2: 97,461,024 (GRCm39) M550T possibly damaging Het
Maml2 A T 9: 13,532,385 (GRCm39) Q533L Het
Mdn1 T A 4: 32,741,344 (GRCm39) D3815E probably damaging Het
Megf8 C T 7: 25,029,353 (GRCm39) A299V possibly damaging Het
Meis3 G T 7: 15,911,481 (GRCm39) E59D probably benign Het
Mppe1 A G 18: 67,358,775 (GRCm39) *398R probably null Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Mtus1 T A 8: 41,537,006 (GRCm39) T237S possibly damaging Het
Ndfip2 T A 14: 105,525,193 (GRCm39) V158E possibly damaging Het
Nrbp2 T G 15: 75,962,746 (GRCm39) T53P probably damaging Het
Nrde2 G A 12: 100,097,094 (GRCm39) P902L probably benign Het
Or10ab5 T A 7: 108,244,879 (GRCm39) K301N probably damaging Het
Or11g24 T A 14: 50,662,792 (GRCm39) M272K probably benign Het
Or2y13 A G 11: 49,415,381 (GRCm39) Y277C probably damaging Het
Or6c202 T C 10: 128,995,924 (GRCm39) M310V probably benign Het
Pcdha1 A G 18: 37,064,115 (GRCm39) T260A probably damaging Het
Pdlim1 T G 19: 40,238,102 (GRCm39) K98N probably damaging Het
Pdxk A T 10: 78,279,764 (GRCm39) probably null Het
Phrf1 G A 7: 140,834,842 (GRCm39) G207R unknown Het
Pik3r6 A G 11: 68,419,389 (GRCm39) K124R probably damaging Het
Polr2b T A 5: 77,488,268 (GRCm39) F823I probably benign Het
Prss58 T C 6: 40,872,322 (GRCm39) I234V probably damaging Het
Ptpn14 A T 1: 189,597,608 (GRCm39) N766I probably benign Het
Qrfprl T A 6: 65,429,940 (GRCm39) I212N probably benign Het
Rgr C T 14: 36,766,552 (GRCm39) D165N probably damaging Het
Rho T C 6: 115,912,200 (GRCm39) F221L probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnase2a A G 14: 51,493,248 (GRCm39) I39T probably damaging Het
Rpl13a T G 7: 44,776,660 (GRCm39) I43L probably benign Het
Rpp30 T C 19: 36,066,558 (GRCm39) V97A probably benign Het
Scube3 T C 17: 28,386,023 (GRCm39) Y755H probably damaging Het
Sec24a A T 11: 51,603,084 (GRCm39) V788E probably damaging Het
Spns2 A T 11: 72,380,443 (GRCm39) L60* probably null Het
Strc T C 2: 121,202,229 (GRCm39) N1213S possibly damaging Het
Tec A T 5: 72,943,367 (GRCm39) I116N possibly damaging Het
Tll1 A T 8: 64,546,988 (GRCm39) D319E probably benign Het
Tmem121b T C 6: 120,470,388 (GRCm39) T110A unknown Het
Tmem232 T A 17: 65,572,213 (GRCm39) I593F probably damaging Het
Tpp2 A G 1: 44,009,626 (GRCm39) I487V probably benign Het
Ubr4 C A 4: 139,136,178 (GRCm39) C934* probably null Het
Vmn1r68 A G 7: 10,261,559 (GRCm39) Y180H probably benign Het
Vmn2r25 T C 6: 123,816,882 (GRCm39) D233G possibly damaging Het
Wdr6 A G 9: 108,453,560 (GRCm39) W108R possibly damaging Het
Zng1 A G 19: 24,920,045 (GRCm39) probably null Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48,573,839 (GRCm39) missense probably damaging 1.00
IGL01103:Repin1 APN 6 48,574,887 (GRCm39) intron probably benign
IGL02027:Repin1 APN 6 48,573,407 (GRCm39) missense probably damaging 1.00
IGL02143:Repin1 APN 6 48,574,055 (GRCm39) missense probably damaging 1.00
R0395:Repin1 UTSW 6 48,574,459 (GRCm39) missense probably damaging 1.00
R1233:Repin1 UTSW 6 48,574,768 (GRCm39) missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48,574,684 (GRCm39) missense probably damaging 0.96
R2259:Repin1 UTSW 6 48,573,464 (GRCm39) missense probably benign 0.00
R4509:Repin1 UTSW 6 48,573,460 (GRCm39) missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48,573,542 (GRCm39) missense probably damaging 1.00
R5009:Repin1 UTSW 6 48,571,779 (GRCm39) intron probably benign
R5425:Repin1 UTSW 6 48,573,365 (GRCm39) missense probably benign 0.18
R5829:Repin1 UTSW 6 48,571,766 (GRCm39) intron probably benign
R6350:Repin1 UTSW 6 48,574,562 (GRCm39) missense probably damaging 0.98
R6841:Repin1 UTSW 6 48,574,859 (GRCm39) missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48,570,825 (GRCm39) intron probably benign
R7067:Repin1 UTSW 6 48,574,850 (GRCm39) nonsense probably null
R7636:Repin1 UTSW 6 48,573,299 (GRCm39) missense probably benign 0.00
R7699:Repin1 UTSW 6 48,574,756 (GRCm39) missense probably damaging 0.96
R7747:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7748:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7781:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7815:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7820:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7869:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7988:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7991:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8078:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8079:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8080:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8088:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8089:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8130:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8131:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8324:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8325:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8342:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8411:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8488:Repin1 UTSW 6 48,570,952 (GRCm39) missense probably damaging 0.98
R8542:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8543:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8544:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8697:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8699:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8701:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8702:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8731:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8732:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8780:Repin1 UTSW 6 48,574,073 (GRCm39) missense probably damaging 0.99
R8879:Repin1 UTSW 6 48,574,367 (GRCm39) missense possibly damaging 0.73
R9049:Repin1 UTSW 6 48,574,646 (GRCm39) missense possibly damaging 0.86
R9465:Repin1 UTSW 6 48,571,877 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GAGTGTGGCAAGAACTTCGG -3'
(R):5'- TGTTGCCAAGGATATCCAGG -3'

Sequencing Primer
(F):5'- TTTCTCACAGGGCAGCCAC -3'
(R):5'- AAGGATATCCAGGCCTGTCTTC -3'
Posted On 2019-11-12