Incidental Mutation 'R7700:Meis3'
ID593937
Institutional Source Beutler Lab
Gene Symbol Meis3
Ensembl Gene ENSMUSG00000041420
Gene NameMeis homeobox 3
SynonymsMrg2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7700 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16175090-16186504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16177556 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 59 (E59D)
Ref Sequence ENSEMBL: ENSMUSP00000002495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002495] [ENSMUST00000176342] [ENSMUST00000176446] [ENSMUST00000176506] [ENSMUST00000177156] [ENSMUST00000177540]
Predicted Effect probably benign
Transcript: ENSMUST00000002495
AA Change: E59D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002495
Gene: ENSMUSG00000041420
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176342
AA Change: E59D

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135302
Gene: ENSMUSG00000041420
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176446
Predicted Effect probably benign
Transcript: ENSMUST00000176506
AA Change: E59D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134918
Gene: ENSMUSG00000041420
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
HOX 248 313 9.15e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177156
AA Change: E59D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135103
Gene: ENSMUSG00000041420
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Pfam:Homeobox_KN 283 313 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177540
AA Change: E59D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135388
Gene: ENSMUSG00000041420
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: The protein encoding this gene belongs to the three amino acid loop extension family of homeodomain transcription factors, which play essential roles in many embryonic processes. These proteins are characterized by an atypical homeodomain containing a three amino acid loop extension between helices 1 and 2. Expression of this gene begins during the compaction stage of embryogenesis and continues into the blastocyst stage. This gene is also expressed in pancreatic islet cells and beta-cells and regulates beta-cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,563,316 probably null Het
1810009A15Rik T C 19: 8,890,053 L72P probably benign Het
4930407I10Rik C A 15: 82,064,105 H734Q probably benign Het
4932438A13Rik T A 3: 36,974,172 N2329K possibly damaging Het
4932438A13Rik C T 3: 37,026,154 S267L probably benign Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Acot4 A T 12: 84,043,237 D236V probably damaging Het
App T A 16: 85,040,309 probably null Het
Arfgef1 G A 1: 10,194,411 T470I possibly damaging Het
Arhgef5 T C 6: 43,274,757 I814T probably benign Het
Atr A T 9: 95,875,690 R968* probably null Het
C130060K24Rik T A 6: 65,452,956 I212N probably benign Het
Capn7 C T 14: 31,352,444 T268I probably benign Het
Cbwd1 A G 19: 24,942,681 probably null Het
Csmd2 G T 4: 128,545,756 probably null Het
Cubn A T 2: 13,348,178 F1916L probably benign Het
Cubn A G 2: 13,489,917 V107A possibly damaging Het
Cyp11b1 T A 15: 74,835,842 T473S probably damaging Het
Cyr61 C T 3: 145,648,692 G155R probably damaging Het
Dip2c T G 13: 9,659,311 S1396A probably benign Het
Dopey2 T G 16: 93,798,761 probably null Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Echdc2 G T 4: 108,174,077 R206L probably benign Het
Ep400 C T 5: 110,696,032 R1594Q unknown Het
Esyt1 T A 10: 128,515,854 probably benign Het
Fmnl2 G A 2: 53,036,508 R69Q Het
Fry T A 5: 150,405,327 H1308Q probably damaging Het
Fyb2 T A 4: 105,010,454 D667E probably benign Het
Gimap7 T A 6: 48,723,857 Y126N possibly damaging Het
Gm1979 A T 5: 26,000,180 W266R probably damaging Het
Gm28042 T A 2: 120,039,716 M712K possibly damaging Het
Gm3238 A G 10: 77,770,635 *231R probably null Het
Gm5592 C A 7: 41,286,407 A111E probably damaging Het
Gm7694 A G 1: 170,301,148 *271Q probably null Het
Gm9195 A C 14: 72,455,902 probably null Het
Ift81 T C 5: 122,594,560 M304V possibly damaging Het
Igfals T C 17: 24,880,574 L213P probably damaging Het
Ints3 G A 3: 90,421,804 P83S probably benign Het
Kcna10 T G 3: 107,195,540 S496A probably damaging Het
Kmt2d G A 15: 98,843,719 A4520V unknown Het
Lemd3 A T 10: 120,978,090 Y413N probably damaging Het
Lgr6 T C 1: 134,996,032 N453S probably damaging Het
Lmtk3 A C 7: 45,792,574 D352A probably damaging Het
Lrrc4c T C 2: 97,630,679 M550T possibly damaging Het
Maml2 A T 9: 13,621,089 Q533L Het
Mdn1 T A 4: 32,741,344 D3815E probably damaging Het
Megf8 C T 7: 25,329,928 A299V possibly damaging Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Mtus1 T A 8: 41,083,969 T237S possibly damaging Het
Ndfip2 T A 14: 105,287,759 V158E possibly damaging Het
Nrbp2 T G 15: 76,090,897 T53P probably damaging Het
Nrde2 G A 12: 100,130,835 P902L probably benign Het
Olfr1383 A G 11: 49,524,554 Y277C probably damaging Het
Olfr509 T A 7: 108,645,672 K301N probably damaging Het
Olfr739 T A 14: 50,425,335 M272K probably benign Het
Olfr771 T C 10: 129,160,055 M310V probably benign Het
Pcdha1 A G 18: 36,931,062 T260A probably damaging Het
Pdlim1 T G 19: 40,249,658 K98N probably damaging Het
Pdxk A T 10: 78,443,930 probably null Het
Phrf1 G A 7: 141,254,929 G207R unknown Het
Pik3r6 A G 11: 68,528,563 K124R probably damaging Het
Polr2b T A 5: 77,340,421 F823I probably benign Het
Prss58 T C 6: 40,895,388 I234V probably damaging Het
Ptpn14 A T 1: 189,865,411 N766I probably benign Het
Repin1 T A 6: 48,597,822 S562T probably damaging Het
Rgr C T 14: 37,044,595 D165N probably damaging Het
Rho T C 6: 115,935,239 F221L probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnase2a A G 14: 51,255,791 I39T probably damaging Het
Rpl13a T G 7: 45,127,236 I43L probably benign Het
Rpp30 T C 19: 36,089,158 V97A probably benign Het
Scube3 T C 17: 28,167,049 Y755H probably damaging Het
Sec24a A T 11: 51,712,257 V788E probably damaging Het
Spns2 A T 11: 72,489,617 L60* probably null Het
Strc T C 2: 121,371,748 N1213S possibly damaging Het
Tec A T 5: 72,786,024 I116N possibly damaging Het
Tll1 A T 8: 64,093,954 D319E probably benign Het
Tmem121b T C 6: 120,493,427 T110A unknown Het
Tmem232 T A 17: 65,265,218 I593F probably damaging Het
Tpp2 A G 1: 43,970,466 I487V probably benign Het
Ubr4 C A 4: 139,408,867 C934* probably null Het
Vmn1r68 A G 7: 10,527,632 Y180H probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Wdr6 A G 9: 108,576,361 W108R possibly damaging Het
Other mutations in Meis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Meis3 APN 7 16178947 critical splice acceptor site probably benign 0.00
IGL02508:Meis3 APN 7 16178797 unclassified probably null
IGL03125:Meis3 APN 7 16178770 missense probably damaging 1.00
IGL03383:Meis3 APN 7 16183819 missense probably damaging 1.00
R0032:Meis3 UTSW 7 16182285 unclassified probably benign
R1147:Meis3 UTSW 7 16183776 unclassified probably benign
R1471:Meis3 UTSW 7 16177571 nonsense probably null
R3054:Meis3 UTSW 7 16182453 missense probably damaging 1.00
R3927:Meis3 UTSW 7 16177494 missense probably benign 0.06
R5314:Meis3 UTSW 7 16184064 missense probably damaging 0.99
R6713:Meis3 UTSW 7 16182330 nonsense probably null
R6847:Meis3 UTSW 7 16183864 missense probably damaging 1.00
R7218:Meis3 UTSW 7 16184701 missense probably benign
R7517:Meis3 UTSW 7 16177818 missense probably damaging 1.00
R7540:Meis3 UTSW 7 16177493 nonsense probably null
R7699:Meis3 UTSW 7 16177556 missense probably benign
R7790:Meis3 UTSW 7 16182397 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTTGGGTAAGGAGACTGAGC -3'
(R):5'- ATGTAGCCAGCTCACACTTCTC -3'

Sequencing Primer
(F):5'- ACTGAGCCCTGGGGAACTAAC -3'
(R):5'- TTCTCAAAGACCAGGGCCAAGAG -3'
Posted On2019-11-12