Incidental Mutation 'R7700:Sec24a'
ID 593955
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene Name SEC24 homolog A, COPII coat complex component
Synonyms 9430090N21Rik
MMRRC Submission 045761-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7700 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 51583090-51649172 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51603084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 788 (V788E)
Ref Sequence ENSEMBL: ENSMUSP00000104725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000109097]
AlphaFold Q3U2P1
Predicted Effect possibly damaging
Transcript: ENSMUST00000038210
AA Change: V787E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: V787E

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109097
AA Change: V788E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: V788E

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,417 (GRCm39) L72P probably benign Het
4930407I10Rik C A 15: 81,948,306 (GRCm39) H734Q probably benign Het
Acadl A G 1: 66,877,522 (GRCm39) V343A possibly damaging Het
Acot4 A T 12: 84,090,011 (GRCm39) D236V probably damaging Het
App T A 16: 84,837,197 (GRCm39) probably null Het
Arfgef1 G A 1: 10,264,636 (GRCm39) T470I possibly damaging Het
Arhgef5 T C 6: 43,251,691 (GRCm39) I814T probably benign Het
Atr A T 9: 95,757,743 (GRCm39) R968* probably null Het
Bltp1 T A 3: 37,028,321 (GRCm39) N2329K possibly damaging Het
Bltp1 C T 3: 37,080,303 (GRCm39) S267L probably benign Het
Capn7 C T 14: 31,074,401 (GRCm39) T268I probably benign Het
Ccdc192 A G 18: 57,696,388 (GRCm39) probably null Het
Ccn1 C T 3: 145,354,447 (GRCm39) G155R probably damaging Het
Csmd2 G T 4: 128,439,549 (GRCm39) probably null Het
Cubn A T 2: 13,352,989 (GRCm39) F1916L probably benign Het
Cubn A G 2: 13,494,728 (GRCm39) V107A possibly damaging Het
Cyp11b1 T A 15: 74,707,691 (GRCm39) T473S probably damaging Het
Dip2c T G 13: 9,709,347 (GRCm39) S1396A probably benign Het
Dop1b T G 16: 93,595,649 (GRCm39) probably null Het
Dyrk1b T C 7: 27,883,737 (GRCm39) Y198H probably damaging Het
Echdc2 G T 4: 108,031,274 (GRCm39) R206L probably benign Het
Ep400 C T 5: 110,843,898 (GRCm39) R1594Q unknown Het
Esyt1 T A 10: 128,351,723 (GRCm39) probably benign Het
Fmnl2 G A 2: 52,926,520 (GRCm39) R69Q Het
Fry T A 5: 150,328,792 (GRCm39) H1308Q probably damaging Het
Fyb2 T A 4: 104,867,651 (GRCm39) D667E probably benign Het
Gimap7 T A 6: 48,700,791 (GRCm39) Y126N possibly damaging Het
Gm1979 A T 5: 26,205,178 (GRCm39) W266R probably damaging Het
Gm28042 T A 2: 119,870,197 (GRCm39) M712K possibly damaging Het
Gm3238 A G 10: 77,606,469 (GRCm39) *231R probably null Het
Gm5592 C A 7: 40,935,831 (GRCm39) A111E probably damaging Het
Gm7694 A G 1: 170,128,717 (GRCm39) *271Q probably null Het
Gm9195 A C 14: 72,693,342 (GRCm39) probably null Het
Ift81 T C 5: 122,732,623 (GRCm39) M304V possibly damaging Het
Igfals T C 17: 25,099,548 (GRCm39) L213P probably damaging Het
Ints3 G A 3: 90,329,111 (GRCm39) P83S probably benign Het
Kcna10 T G 3: 107,102,856 (GRCm39) S496A probably damaging Het
Kmt2d G A 15: 98,741,600 (GRCm39) A4520V unknown Het
Lemd3 A T 10: 120,813,995 (GRCm39) Y413N probably damaging Het
Lgr6 T C 1: 134,923,770 (GRCm39) N453S probably damaging Het
Lmtk3 A C 7: 45,441,998 (GRCm39) D352A probably damaging Het
Lrrc4c T C 2: 97,461,024 (GRCm39) M550T possibly damaging Het
Maml2 A T 9: 13,532,385 (GRCm39) Q533L Het
Mdn1 T A 4: 32,741,344 (GRCm39) D3815E probably damaging Het
Megf8 C T 7: 25,029,353 (GRCm39) A299V possibly damaging Het
Meis3 G T 7: 15,911,481 (GRCm39) E59D probably benign Het
Mppe1 A G 18: 67,358,775 (GRCm39) *398R probably null Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Mtus1 T A 8: 41,537,006 (GRCm39) T237S possibly damaging Het
Ndfip2 T A 14: 105,525,193 (GRCm39) V158E possibly damaging Het
Nrbp2 T G 15: 75,962,746 (GRCm39) T53P probably damaging Het
Nrde2 G A 12: 100,097,094 (GRCm39) P902L probably benign Het
Or10ab5 T A 7: 108,244,879 (GRCm39) K301N probably damaging Het
Or11g24 T A 14: 50,662,792 (GRCm39) M272K probably benign Het
Or2y13 A G 11: 49,415,381 (GRCm39) Y277C probably damaging Het
Or6c202 T C 10: 128,995,924 (GRCm39) M310V probably benign Het
Pcdha1 A G 18: 37,064,115 (GRCm39) T260A probably damaging Het
Pdlim1 T G 19: 40,238,102 (GRCm39) K98N probably damaging Het
Pdxk A T 10: 78,279,764 (GRCm39) probably null Het
Phrf1 G A 7: 140,834,842 (GRCm39) G207R unknown Het
Pik3r6 A G 11: 68,419,389 (GRCm39) K124R probably damaging Het
Polr2b T A 5: 77,488,268 (GRCm39) F823I probably benign Het
Prss58 T C 6: 40,872,322 (GRCm39) I234V probably damaging Het
Ptpn14 A T 1: 189,597,608 (GRCm39) N766I probably benign Het
Qrfprl T A 6: 65,429,940 (GRCm39) I212N probably benign Het
Repin1 T A 6: 48,574,756 (GRCm39) S562T probably damaging Het
Rgr C T 14: 36,766,552 (GRCm39) D165N probably damaging Het
Rho T C 6: 115,912,200 (GRCm39) F221L probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnase2a A G 14: 51,493,248 (GRCm39) I39T probably damaging Het
Rpl13a T G 7: 44,776,660 (GRCm39) I43L probably benign Het
Rpp30 T C 19: 36,066,558 (GRCm39) V97A probably benign Het
Scube3 T C 17: 28,386,023 (GRCm39) Y755H probably damaging Het
Spns2 A T 11: 72,380,443 (GRCm39) L60* probably null Het
Strc T C 2: 121,202,229 (GRCm39) N1213S possibly damaging Het
Tec A T 5: 72,943,367 (GRCm39) I116N possibly damaging Het
Tll1 A T 8: 64,546,988 (GRCm39) D319E probably benign Het
Tmem121b T C 6: 120,470,388 (GRCm39) T110A unknown Het
Tmem232 T A 17: 65,572,213 (GRCm39) I593F probably damaging Het
Tpp2 A G 1: 44,009,626 (GRCm39) I487V probably benign Het
Ubr4 C A 4: 139,136,178 (GRCm39) C934* probably null Het
Vmn1r68 A G 7: 10,261,559 (GRCm39) Y180H probably benign Het
Vmn2r25 T C 6: 123,816,882 (GRCm39) D233G possibly damaging Het
Wdr6 A G 9: 108,453,560 (GRCm39) W108R possibly damaging Het
Zng1 A G 19: 24,920,045 (GRCm39) probably null Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51,627,331 (GRCm39) nonsense probably null
IGL00973:Sec24a APN 11 51,620,404 (GRCm39) critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51,604,356 (GRCm39) critical splice donor site probably null
IGL01476:Sec24a APN 11 51,599,783 (GRCm39) missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51,614,405 (GRCm39) splice site probably null
IGL02069:Sec24a APN 11 51,624,761 (GRCm39) splice site probably benign
IGL02230:Sec24a APN 11 51,599,861 (GRCm39) missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51,603,014 (GRCm39) critical splice donor site probably null
IGL02655:Sec24a APN 11 51,625,482 (GRCm39) missense probably benign 0.43
IGL02756:Sec24a APN 11 51,587,560 (GRCm39) missense probably benign 0.02
IGL03396:Sec24a APN 11 51,599,794 (GRCm39) missense probably benign 0.17
R0153:Sec24a UTSW 11 51,591,653 (GRCm39) missense probably benign 0.08
R0506:Sec24a UTSW 11 51,634,622 (GRCm39) missense probably benign 0.03
R0625:Sec24a UTSW 11 51,620,281 (GRCm39) missense probably damaging 0.98
R1084:Sec24a UTSW 11 51,604,408 (GRCm39) missense probably damaging 1.00
R1166:Sec24a UTSW 11 51,624,294 (GRCm39) missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51,591,740 (GRCm39) splice site probably benign
R1487:Sec24a UTSW 11 51,622,713 (GRCm39) missense possibly damaging 0.92
R1541:Sec24a UTSW 11 51,634,623 (GRCm39) missense probably benign 0.41
R1582:Sec24a UTSW 11 51,599,794 (GRCm39) missense probably benign 0.17
R1643:Sec24a UTSW 11 51,595,212 (GRCm39) missense probably benign 0.03
R1672:Sec24a UTSW 11 51,634,775 (GRCm39) nonsense probably null
R1681:Sec24a UTSW 11 51,586,016 (GRCm39) missense probably damaging 0.98
R1756:Sec24a UTSW 11 51,624,590 (GRCm39) splice site probably benign
R1992:Sec24a UTSW 11 51,627,190 (GRCm39) missense probably benign 0.00
R2159:Sec24a UTSW 11 51,603,177 (GRCm39) missense probably damaging 1.00
R2177:Sec24a UTSW 11 51,595,228 (GRCm39) missense probably benign 0.00
R2188:Sec24a UTSW 11 51,614,411 (GRCm39) missense probably damaging 0.99
R2271:Sec24a UTSW 11 51,607,277 (GRCm39) missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51,620,285 (GRCm39) missense probably damaging 1.00
R4349:Sec24a UTSW 11 51,605,976 (GRCm39) missense probably benign 0.03
R4396:Sec24a UTSW 11 51,605,991 (GRCm39) missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51,612,640 (GRCm39) critical splice donor site probably null
R5061:Sec24a UTSW 11 51,604,359 (GRCm39) splice site probably null
R5577:Sec24a UTSW 11 51,625,448 (GRCm39) missense probably benign 0.06
R5717:Sec24a UTSW 11 51,598,037 (GRCm39) missense probably benign
R5915:Sec24a UTSW 11 51,646,964 (GRCm39) missense probably benign 0.11
R6175:Sec24a UTSW 11 51,622,718 (GRCm39) missense probably damaging 1.00
R6341:Sec24a UTSW 11 51,608,603 (GRCm39) missense probably damaging 0.99
R6461:Sec24a UTSW 11 51,604,373 (GRCm39) missense possibly damaging 0.76
R6610:Sec24a UTSW 11 51,587,483 (GRCm39) missense probably benign
R6632:Sec24a UTSW 11 51,604,476 (GRCm39) nonsense probably null
R6907:Sec24a UTSW 11 51,603,103 (GRCm39) missense probably damaging 1.00
R6969:Sec24a UTSW 11 51,591,643 (GRCm39) missense probably benign 0.35
R7132:Sec24a UTSW 11 51,605,963 (GRCm39) nonsense probably null
R7274:Sec24a UTSW 11 51,598,082 (GRCm39) missense probably damaging 1.00
R7475:Sec24a UTSW 11 51,604,379 (GRCm39) missense probably damaging 1.00
R7699:Sec24a UTSW 11 51,603,084 (GRCm39) missense probably damaging 1.00
R7935:Sec24a UTSW 11 51,612,749 (GRCm39) missense probably benign 0.25
R8042:Sec24a UTSW 11 51,595,144 (GRCm39) missense probably benign
R8345:Sec24a UTSW 11 51,634,605 (GRCm39) missense probably benign 0.00
R9217:Sec24a UTSW 11 51,617,331 (GRCm39) missense probably benign 0.14
R9501:Sec24a UTSW 11 51,603,122 (GRCm39) missense probably damaging 1.00
X0025:Sec24a UTSW 11 51,620,374 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGTTGAGAGGCTAGGTCTC -3'
(R):5'- GAGTGCTCTGTCTTCTCTAAGCTG -3'

Sequencing Primer
(F):5'- GTCTATACAGTTAGTTCCAGGCCAG -3'
(R):5'- AAGCTGTTTATTCTCTGATAAAGGAG -3'
Posted On 2019-11-12