Mutagenetix > Incidental Mutation

Incidental Mutation 'R7701:Eif2a'

593990

Institutional Source

Beutler Lab

Gene Symbol

Eif2a

Ensembl Gene

ENSMUSG00000027810

Gene Name

eukaryotic translation initiation factor 2A

Synonyms

D3Ertd194e

MMRRC Submission

045762-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7701 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58433252-58464922 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58459991 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 462 (H462L)

Ref Sequence

ENSEMBL: ENSMUSP00000029387 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000154219]

AlphaFold

Q8BJW6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029387
AA Change: H462L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: H462L

Domain	Start	End	E-Value	Type
low complexity region	145	159	N/A	INTRINSIC
Pfam:eIF2A	216	411	1e-77	PFAM
low complexity region	488	502	N/A	INTRINSIC
coiled coil region	528	575	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135876

Predicted Effect

probably benign
Transcript: ENSMUST00000154219

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	T	C	2: 170,443,225 (GRCm39)		probably benign	Het
4932414N04Rik	G	A	2: 68,561,548 (GRCm39)	V292M	possibly damaging	Het
Actn1	A	T	12: 80,221,328 (GRCm39)	V575E	possibly damaging	Het
Arhgef1	T	C	7: 24,612,003 (GRCm39)	S129P	probably benign	Het
Aup1	T	C	6: 83,032,908 (GRCm39)	V214A	probably benign	Het
Bbs10	A	G	10: 111,135,874 (GRCm39)	E329G	probably damaging	Het
Brinp2	A	G	1: 158,094,030 (GRCm39)		probably null	Het
Ccdc3	A	G	2: 5,142,868 (GRCm39)	T42A	possibly damaging	Het
Cd276	T	C	9: 58,442,810 (GRCm39)	N215S	probably benign	Het
Col24a1	T	A	3: 145,020,772 (GRCm39)	M381K	probably benign	Het
Col24a1	A	G	3: 145,072,656 (GRCm39)		probably null	Het
Col6a4	A	C	9: 105,960,087 (GRCm39)	F19V	probably benign	Het
Crybg1	G	T	10: 43,865,139 (GRCm39)	A1446E	probably benign	Het
Dach1	C	T	14: 98,140,670 (GRCm39)	R496K	probably damaging	Het
Dchs2	A	G	3: 83,253,513 (GRCm39)	T2308A	possibly damaging	Het
Duxf1	A	G	10: 58,058,885 (GRCm39)	V623A	possibly damaging	Het
Dync1h1	G	A	12: 110,585,080 (GRCm39)	D828N	probably damaging	Het
Flot2	A	G	11: 77,928,942 (GRCm39)		probably null	Het
Gas2	T	G	7: 51,643,101 (GRCm39)	Y263*	probably null	Het
Gm5111	A	G	6: 48,567,027 (GRCm39)	I81V	unknown	Het
Iqcm	A	G	8: 76,281,539 (GRCm39)	I7M	probably benign	Het
Kank1	G	A	19: 25,389,129 (GRCm39)		probably null	Het
Lnx2	A	T	5: 146,961,333 (GRCm39)	V533E	probably damaging	Het
Mapk8ip3	G	T	17: 25,120,378 (GRCm39)	P904T	possibly damaging	Het
Mcm5	C	A	8: 75,850,551 (GRCm39)	H596N	probably benign	Het
Miip	A	T	4: 147,947,371 (GRCm39)	V237E	probably null	Het
Mob3a	G	A	10: 80,525,768 (GRCm39)	A181V	probably damaging	Het
Mrpl38	G	A	11: 116,026,104 (GRCm39)	R99W	probably benign	Het
Naa25	A	G	5: 121,564,042 (GRCm39)	T486A	probably benign	Het
Or2z9	T	A	8: 72,854,030 (GRCm39)	L142Q	probably damaging	Het
Or5b102	A	G	19: 13,041,445 (GRCm39)	I223M	probably damaging	Het
Or8g4	A	G	9: 39,662,597 (GRCm39)	Y305C	probably benign	Het
Pcdha8	A	T	18: 37,126,864 (GRCm39)	N449Y	probably damaging	Het
Pcdhb6	A	T	18: 37,467,562 (GRCm39)	D161V	probably damaging	Het
Pdlim3	A	G	8: 46,361,576 (GRCm39)	D134G	probably benign	Het
Phpt1	A	G	2: 25,464,799 (GRCm39)	V18A	probably benign	Het
Prg4	T	C	1: 150,333,293 (GRCm39)	K177E	possibly damaging	Het
Psmb1	A	G	17: 15,697,509 (GRCm39)	F202S	probably benign	Het
Rab14	A	G	2: 35,073,427 (GRCm39)	F150L		Het
Rgs14	A	G	13: 55,527,138 (GRCm39)	D169G	probably damaging	Het
Rreb1	C	T	13: 38,114,092 (GRCm39)	L484F	possibly damaging	Het
Rsph14	A	T	10: 74,793,608 (GRCm39)	Y264*	probably null	Het
Scly	T	C	1: 91,236,030 (GRCm39)	I152T		Het
Ska1	A	T	18: 74,335,714 (GRCm39)	H85Q	probably damaging	Het
Slc35b3	T	C	13: 39,128,611 (GRCm39)	M159V	probably benign	Het
Smok2b	A	G	17: 13,453,767 (GRCm39)		probably benign	Het
Spock1	G	A	13: 57,735,472 (GRCm39)	Q103*	probably null	Het
Topbp1	T	C	9: 103,210,184 (GRCm39)	V914A	probably damaging	Het
Tspan3	A	T	9: 56,054,803 (GRCm39)	Y41*	probably null	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,376,118 (GRCm39)		probably null	Het
Ttn	T	G	2: 76,560,028 (GRCm39)	I29458L	possibly damaging	Het
Tubgcp3	A	G	8: 12,705,974 (GRCm39)	S183P	probably benign	Het
Zfat	C	A	15: 68,052,757 (GRCm39)	E346*	probably null	Het
Zfp341	T	A	2: 154,476,000 (GRCm39)		probably null	Het
Zfp54	A	G	17: 21,654,357 (GRCm39)	T284A	probably benign	Het

Other mutations in Eif2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Eif2a	APN	3	58,456,024 (GRCm39)	missense	possibly damaging	0.89
IGL02823:Eif2a	APN	3	58,456,092 (GRCm39)	missense	probably benign	0.01
IGL03086:Eif2a	APN	3	58,448,538 (GRCm39)	missense	probably benign	0.00
IGL03165:Eif2a	APN	3	58,456,049 (GRCm39)	nonsense	probably null
1mM(1):Eif2a	UTSW	3	58,452,724 (GRCm39)	missense	possibly damaging	0.75
PIT4576001:Eif2a	UTSW	3	58,452,974 (GRCm39)	missense	probably damaging	1.00
R0540:Eif2a	UTSW	3	58,463,073 (GRCm39)	critical splice donor site	probably null
R0607:Eif2a	UTSW	3	58,463,073 (GRCm39)	critical splice donor site	probably null
R1061:Eif2a	UTSW	3	58,452,486 (GRCm39)	nonsense	probably null
R1499:Eif2a	UTSW	3	58,445,005 (GRCm39)	nonsense	probably null
R1922:Eif2a	UTSW	3	58,455,951 (GRCm39)	missense	probably damaging	1.00
R3980:Eif2a	UTSW	3	58,446,960 (GRCm39)	missense	probably benign	0.00
R4017:Eif2a	UTSW	3	58,452,776 (GRCm39)	missense	probably damaging	1.00
R4080:Eif2a	UTSW	3	58,447,050 (GRCm39)	missense	possibly damaging	0.52
R5528:Eif2a	UTSW	3	58,455,933 (GRCm39)	missense	probably damaging	1.00
R6320:Eif2a	UTSW	3	58,464,517 (GRCm39)	splice site	probably null
R7081:Eif2a	UTSW	3	58,449,139 (GRCm39)	critical splice donor site	probably null
R7414:Eif2a	UTSW	3	58,433,502 (GRCm39)	nonsense	probably null
R7447:Eif2a	UTSW	3	58,452,963 (GRCm39)	missense	probably damaging	0.97
R7497:Eif2a	UTSW	3	58,456,102 (GRCm39)	missense	probably damaging	1.00
R8205:Eif2a	UTSW	3	58,456,156 (GRCm39)	missense	probably damaging	1.00
R8826:Eif2a	UTSW	3	58,456,049 (GRCm39)	nonsense	probably null
R9103:Eif2a	UTSW	3	58,452,461 (GRCm39)	missense
R9165:Eif2a	UTSW	3	58,452,695 (GRCm39)	missense	probably damaging	1.00
R9232:Eif2a	UTSW	3	58,463,022 (GRCm39)	missense	probably benign
R9280:Eif2a	UTSW	3	58,447,009 (GRCm39)	intron	probably benign
R9492:Eif2a	UTSW	3	58,448,475 (GRCm39)	missense	probably benign	0.00
R9524:Eif2a	UTSW	3	58,448,467 (GRCm39)	missense	possibly damaging	0.87
Z1176:Eif2a	UTSW	3	58,456,305 (GRCm39)	missense	probably benign
Z1177:Eif2a	UTSW	3	58,438,541 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAGCTAATGGGGAGGTCC -3'
(R):5'- AATACTTAGTCCACAGGCAGGC -3'

Sequencing Primer
(F):5'- AGCTAATGGGGAGGTCCTTATTTAAC -3'
(R):5'- GTCCACAGGCAGGCACAAAAG -3'

Posted On

2019-11-12