Mutagenetix > Incidental Mutation

Incidental Mutation 'R7701:Col24a1'

593992

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

045762-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7701 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 145315011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 381 (M381K)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: M381K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: M381K

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Meta Mutation Damage Score

0.0746

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	T	C	2: 170,601,305		probably benign	Het
4932414N04Rik	G	A	2: 68,731,204	V292M	possibly damaging	Het
Actn1	A	T	12: 80,174,554	V575E	possibly damaging	Het
Arhgef1	T	C	7: 24,912,578	S129P	probably benign	Het
Aup1	T	C	6: 83,055,927	V214A	probably benign	Het
AW822073	A	G	10: 58,223,063	V623A	possibly damaging	Het
Bbs10	A	G	10: 111,300,013	E329G	probably damaging	Het
Brinp2	A	G	1: 158,266,460		probably null	Het
Ccdc3	A	G	2: 5,138,057	T42A	possibly damaging	Het
Cd276	T	C	9: 58,535,527	N215S	probably benign	Het
Col6a4	A	C	9: 106,082,888	F19V	probably benign	Het
Crybg1	G	T	10: 43,989,143	A1446E	probably benign	Het
Dach1	C	T	14: 97,903,234	R496K	probably damaging	Het
Dchs2	A	G	3: 83,346,206	T2308A	possibly damaging	Het
Dync1h1	G	A	12: 110,618,646	D828N	probably damaging	Het
Eif2a	A	T	3: 58,552,570	H462L	possibly damaging	Het
Flot2	A	G	11: 78,038,116		probably null	Het
Gas2	T	G	7: 51,993,353	Y263*	probably null	Het
Gm5111	A	G	6: 48,590,093	I81V	unknown	Het
Iqcm	A	G	8: 75,554,911	I7M	probably benign	Het
Kank1	G	A	19: 25,411,765		probably null	Het
Lnx2	A	T	5: 147,024,523	V533E	probably damaging	Het
Mapk8ip3	G	T	17: 24,901,404	P904T	possibly damaging	Het
Mcm5	C	A	8: 75,123,923	H596N	probably benign	Het
Miip	A	T	4: 147,862,914	V237E	probably null	Het
Mob3a	G	A	10: 80,689,934	A181V	probably damaging	Het
Mrpl38	G	A	11: 116,135,278	R99W	probably benign	Het
Naa25	A	G	5: 121,425,979	T486A	probably benign	Het
Olfr1454	A	G	19: 13,064,081	I223M	probably damaging	Het
Olfr373	T	A	8: 72,100,186	L142Q	probably damaging	Het
Olfr967	A	G	9: 39,751,301	Y305C	probably benign	Het
Pcdha8	A	T	18: 36,993,811	N449Y	probably damaging	Het
Pcdhb6	A	T	18: 37,334,509	D161V	probably damaging	Het
Pdlim3	A	G	8: 45,908,539	D134G	probably benign	Het
Phpt1	A	G	2: 25,574,787	V18A	probably benign	Het
Prg4	T	C	1: 150,457,542	K177E	possibly damaging	Het
Psmb1	A	G	17: 15,477,247	F202S	probably benign	Het
Rab14	A	G	2: 35,183,415	F150L		Het
Rgs14	A	G	13: 55,379,325	D169G	probably damaging	Het
Rreb1	C	T	13: 37,930,116	L484F	possibly damaging	Het
Rsph14	A	T	10: 74,957,776	Y264*	probably null	Het
Scly	T	C	1: 91,308,308	I152T		Het
Ska1	A	T	18: 74,202,643	H85Q	probably damaging	Het
Slc35b3	T	C	13: 38,944,635	M159V	probably benign	Het
Smok2b	A	G	17: 13,234,880		probably benign	Het
Spock1	G	A	13: 57,587,659	Q103*	probably null	Het
Topbp1	T	C	9: 103,332,985	V914A	probably damaging	Het
Tspan3	A	T	9: 56,147,519	Y41*	probably null	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	T	G	2: 76,729,684	I29458L	possibly damaging	Het
Tubgcp3	A	G	8: 12,655,974	S183P	probably benign	Het
Zfat	C	A	15: 68,180,908	E346*	probably null	Het
Zfp341	T	A	2: 154,634,080		probably null	Het
Zfp54	A	G	17: 21,434,095	T284A	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCTGCCACGGTACATGAAAG -3'
(R):5'- ATACAAGGTGCTGTTTAAGATCCG -3'

Sequencing Primer
(F):5'- GCCACGGTACATGAAAGCCAAG -3'
(R):5'- AAGATCCGTTCCATTTCTATGAGC -3'

Posted On

2019-11-12