Mutagenetix > Incidental Mutation

Incidental Mutation 'R7701:Miip'

593993

Institutional Source

Beutler Lab

Gene Symbol

Miip

Ensembl Gene

ENSMUSG00000029022

Gene Name

migration and invasion inhibitory protein

Synonyms

D4Wsu114e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7701 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

147860778-147868816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 147862914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 237 (V237E)

Ref Sequence

ENSEMBL: ENSMUSP00000113897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]

AlphaFold

A2A7Y5

Predicted Effect

probably null
Transcript: ENSMUST00000030886
AA Change: V237E

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: V237E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119975
AA Change: V237E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: V237E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
Pfam:MIIP	41	382	1.4e-142	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000172710
AA Change: V237E

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: V237E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Meta Mutation Damage Score

0.1624

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	T	C	2: 170,601,305		probably benign	Het
4932414N04Rik	G	A	2: 68,731,204	V292M	possibly damaging	Het
Actn1	A	T	12: 80,174,554	V575E	possibly damaging	Het
Arhgef1	T	C	7: 24,912,578	S129P	probably benign	Het
Aup1	T	C	6: 83,055,927	V214A	probably benign	Het
AW822073	A	G	10: 58,223,063	V623A	possibly damaging	Het
Bbs10	A	G	10: 111,300,013	E329G	probably damaging	Het
Brinp2	A	G	1: 158,266,460		probably null	Het
Ccdc3	A	G	2: 5,138,057	T42A	possibly damaging	Het
Cd276	T	C	9: 58,535,527	N215S	probably benign	Het
Col24a1	T	A	3: 145,315,011	M381K	probably benign	Het
Col24a1	A	G	3: 145,366,901		probably null	Het
Col6a4	A	C	9: 106,082,888	F19V	probably benign	Het
Crybg1	G	T	10: 43,989,143	A1446E	probably benign	Het
Dach1	C	T	14: 97,903,234	R496K	probably damaging	Het
Dchs2	A	G	3: 83,346,206	T2308A	possibly damaging	Het
Dync1h1	G	A	12: 110,618,646	D828N	probably damaging	Het
Eif2a	A	T	3: 58,552,570	H462L	possibly damaging	Het
Flot2	A	G	11: 78,038,116		probably null	Het
Gas2	T	G	7: 51,993,353	Y263*	probably null	Het
Gm5111	A	G	6: 48,590,093	I81V	unknown	Het
Iqcm	A	G	8: 75,554,911	I7M	probably benign	Het
Kank1	G	A	19: 25,411,765		probably null	Het
Lnx2	A	T	5: 147,024,523	V533E	probably damaging	Het
Mapk8ip3	G	T	17: 24,901,404	P904T	possibly damaging	Het
Mcm5	C	A	8: 75,123,923	H596N	probably benign	Het
Mob3a	G	A	10: 80,689,934	A181V	probably damaging	Het
Mrpl38	G	A	11: 116,135,278	R99W	probably benign	Het
Naa25	A	G	5: 121,425,979	T486A	probably benign	Het
Olfr1454	A	G	19: 13,064,081	I223M	probably damaging	Het
Olfr373	T	A	8: 72,100,186	L142Q	probably damaging	Het
Olfr967	A	G	9: 39,751,301	Y305C	probably benign	Het
Pcdha8	A	T	18: 36,993,811	N449Y	probably damaging	Het
Pcdhb6	A	T	18: 37,334,509	D161V	probably damaging	Het
Pdlim3	A	G	8: 45,908,539	D134G	probably benign	Het
Phpt1	A	G	2: 25,574,787	V18A	probably benign	Het
Prg4	T	C	1: 150,457,542	K177E	possibly damaging	Het
Psmb1	A	G	17: 15,477,247	F202S	probably benign	Het
Rab14	A	G	2: 35,183,415	F150L		Het
Rgs14	A	G	13: 55,379,325	D169G	probably damaging	Het
Rreb1	C	T	13: 37,930,116	L484F	possibly damaging	Het
Rsph14	A	T	10: 74,957,776	Y264*	probably null	Het
Scly	T	C	1: 91,308,308	I152T		Het
Ska1	A	T	18: 74,202,643	H85Q	probably damaging	Het
Slc35b3	T	C	13: 38,944,635	M159V	probably benign	Het
Smok2b	A	G	17: 13,234,880		probably benign	Het
Spock1	G	A	13: 57,587,659	Q103*	probably null	Het
Topbp1	T	C	9: 103,332,985	V914A	probably damaging	Het
Tspan3	A	T	9: 56,147,519	Y41*	probably null	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	T	G	2: 76,729,684	I29458L	possibly damaging	Het
Tubgcp3	A	G	8: 12,655,974	S183P	probably benign	Het
Zfat	C	A	15: 68,180,908	E346*	probably null	Het
Zfp341	T	A	2: 154,634,080		probably null	Het
Zfp54	A	G	17: 21,434,095	T284A	probably benign	Het

Other mutations in Miip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Miip	APN	4	147865865	missense	probably damaging	1.00
IGL02134:Miip	APN	4	147865278	splice site	probably benign
IGL02829:Miip	APN	4	147863061	missense	probably benign	0.01
IGL03350:Miip	APN	4	147862522	missense	probably benign	0.01
R0200:Miip	UTSW	4	147862263	missense	probably damaging	0.99
R1647:Miip	UTSW	4	147865234	missense	probably benign	0.02
R1783:Miip	UTSW	4	147865774	missense	probably damaging	1.00
R1848:Miip	UTSW	4	147863092	missense	probably damaging	0.99
R1944:Miip	UTSW	4	147865965	missense	probably benign	0.15
R3615:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3616:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3882:Miip	UTSW	4	147861052	missense	possibly damaging	0.93
R4579:Miip	UTSW	4	147861061	missense	probably damaging	1.00
R5183:Miip	UTSW	4	147863069	missense	probably damaging	1.00
R6054:Miip	UTSW	4	147865678	missense	probably benign	0.00
R6056:Miip	UTSW	4	147862335	missense	probably damaging	1.00
R6304:Miip	UTSW	4	147863083	missense	probably benign	0.12
R6568:Miip	UTSW	4	147865915	missense	probably benign
R6603:Miip	UTSW	4	147865923	missense	possibly damaging	0.92
R7639:Miip	UTSW	4	147862564	missense	probably benign	0.22
R7795:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7796:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7797:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7872:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7920:Miip	UTSW	4	147862918	missense	probably benign	0.17
R8468:Miip	UTSW	4	147861471	missense	probably damaging	1.00
R8492:Miip	UTSW	4	147861424	missense	probably damaging	1.00
R8677:Miip	UTSW	4	147863046	missense	probably damaging	1.00
R8852:Miip	UTSW	4	147866382	start gained	probably benign
R8860:Miip	UTSW	4	147866382	start gained	probably benign
R9755:Miip	UTSW	4	147865862	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGTCAGGGAGAAATGTCCTC -3'
(R):5'- AGCTCTCCAGTCACTAGTGAG -3'

Sequencing Primer
(F):5'- AGAAATGTCCTCCCAGGGG -3'
(R):5'- AGTCACTAGTGAGCCCGAG -3'

Posted On

2019-11-12