Incidental Mutation 'R7701:Naa25'
ID593994
Institutional Source Beutler Lab
Gene Symbol Naa25
Ensembl Gene ENSMUSG00000042719
Gene NameN(alpha)-acetyltransferase 25, NatB auxiliary subunit
SynonymsC330023M02Rik, 4833422K13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7701 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121397936-121444378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121425979 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 486 (T486A)
Ref Sequence ENSEMBL: ENSMUSP00000038977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000151458] [ENSMUST00000153758] [ENSMUST00000173895]
Predicted Effect probably benign
Transcript: ENSMUST00000042163
AA Change: T486A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719
AA Change: T486A

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151458
SMART Domains Protein: ENSMUSP00000120970
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
SCOP:d1a17__ 21 94 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153758
SMART Domains Protein: ENSMUSP00000122522
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 55 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173895
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col24a1 A G 3: 145,366,901 probably null Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Flot2 A G 11: 78,038,116 probably null Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Smok2b A G 17: 13,234,880 probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp341 T A 2: 154,634,080 probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Naa25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Naa25 APN 5 121439865 missense probably damaging 1.00
IGL02142:Naa25 APN 5 121426762 missense possibly damaging 0.52
IGL02541:Naa25 APN 5 121424531 missense possibly damaging 0.92
IGL02747:Naa25 APN 5 121414605 splice site probably benign
IGL03074:Naa25 APN 5 121408337 critical splice donor site probably null
IGL03119:Naa25 APN 5 121434978 missense probably null 1.00
IGL03218:Naa25 APN 5 121426070 missense probably damaging 1.00
R0003:Naa25 UTSW 5 121407184 intron probably benign
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0399:Naa25 UTSW 5 121435490 missense probably benign 0.00
R0973:Naa25 UTSW 5 121438716 splice site probably benign
R1418:Naa25 UTSW 5 121423734 missense probably damaging 1.00
R1582:Naa25 UTSW 5 121434829 missense probably benign
R1793:Naa25 UTSW 5 121417415 missense possibly damaging 0.82
R1793:Naa25 UTSW 5 121420593 missense probably damaging 1.00
R1863:Naa25 UTSW 5 121435548 missense probably benign 0.00
R3160:Naa25 UTSW 5 121435072 splice site probably null
R3162:Naa25 UTSW 5 121435072 splice site probably null
R3721:Naa25 UTSW 5 121431556 missense probably benign
R3864:Naa25 UTSW 5 121409197 missense probably damaging 0.96
R4852:Naa25 UTSW 5 121430692 missense probably damaging 1.00
R5077:Naa25 UTSW 5 121424576 missense probably benign 0.02
R5602:Naa25 UTSW 5 121420495 missense probably benign 0.30
R5855:Naa25 UTSW 5 121423692 missense possibly damaging 0.94
R6464:Naa25 UTSW 5 121417961 missense probably damaging 1.00
R6734:Naa25 UTSW 5 121438825 missense possibly damaging 0.65
R6750:Naa25 UTSW 5 121408309 missense probably damaging 1.00
R6767:Naa25 UTSW 5 121439865 missense probably damaging 1.00
R6856:Naa25 UTSW 5 121438804 missense probably damaging 1.00
R7145:Naa25 UTSW 5 121417489 critical splice donor site probably null
R7631:Naa25 UTSW 5 121438728 missense possibly damaging 0.92
R7800:Naa25 UTSW 5 121424531 missense possibly damaging 0.92
R7804:Naa25 UTSW 5 121424589 missense probably benign 0.00
R7822:Naa25 UTSW 5 121407213 missense probably damaging 1.00
X0004:Naa25 UTSW 5 121413081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAGCTCTATTTAAGCACTG -3'
(R):5'- TGCTCGGTACTCAGAGTGTATAC -3'

Sequencing Primer
(F):5'- ATTTGAACTCGGGACCGACTCTG -3'
(R):5'- GGTACTCAGAGTGTATACTACCAAC -3'
Posted On2019-11-12