Incidental Mutation 'R7701:Gas2'
ID594000
Institutional Source Beutler Lab
Gene Symbol Gas2
Ensembl Gene ENSMUSG00000030498
Gene Namegrowth arrest specific 2
SynonymsGas-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7701 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location51862015-51994975 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 51993353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 263 (Y263*)
Ref Sequence ENSEMBL: ENSMUSP00000053514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051912] [ENSMUST00000098414] [ENSMUST00000107591] [ENSMUST00000129604] [ENSMUST00000208711]
PDB Structure
Solution Structure of the Gas2 Domain of the Growth Arrest Specific 2 Protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000051912
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000053514
Gene: ENSMUSG00000030498
AA Change: Y263*

DomainStartEndE-ValueType
CH 37 153 5.69e-15 SMART
low complexity region 167 178 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
GAS2 201 274 5.07e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098414
SMART Domains Protein: ENSMUSP00000096014
Gene: ENSMUSG00000074093

DomainStartEndE-ValueType
Pfam:SVIP 1 73 1.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107591
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000103217
Gene: ENSMUSG00000030498
AA Change: Y263*

DomainStartEndE-ValueType
CH 37 153 5.69e-15 SMART
low complexity region 167 178 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
GAS2 201 274 5.07e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129604
Predicted Effect probably null
Transcript: ENSMUST00000208711
AA Change: Y263*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col24a1 A G 3: 145,366,901 probably null Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Flot2 A G 11: 78,038,116 probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Smok2b A G 17: 13,234,880 probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp341 T A 2: 154,634,080 probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Gas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Gas2 APN 7 51888038 missense probably damaging 1.00
IGL02539:Gas2 APN 7 51897290 missense possibly damaging 0.96
IGL02557:Gas2 APN 7 51887933 missense probably damaging 0.98
IGL02656:Gas2 APN 7 51943744 missense probably benign
R1702:Gas2 UTSW 7 51953341 intron probably null
R1826:Gas2 UTSW 7 51943673 missense probably damaging 1.00
R2078:Gas2 UTSW 7 51897325 missense probably benign 0.04
R3826:Gas2 UTSW 7 51936619 critical splice donor site probably null
R5985:Gas2 UTSW 7 51943676 missense probably damaging 1.00
R6510:Gas2 UTSW 7 51943712 missense probably damaging 0.97
R7216:Gas2 UTSW 7 51897257 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAAGCCTTGTCCCAAGCAG -3'
(R):5'- TTGCATGAGTCCTCTTTCAGAG -3'

Sequencing Primer
(F):5'- TTGTCCCAAGCAGATACAGTG -3'
(R):5'- TCATGTCCTTCAGGGTTG -3'
Posted On2019-11-12