Incidental Mutation 'R7701:Tubgcp3'
ID594001
Institutional Source Beutler Lab
Gene Symbol Tubgcp3
Ensembl Gene ENSMUSG00000000759
Gene Nametubulin, gamma complex associated protein 3
SynonymsSpc98p, GCP3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7701 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location12614277-12672248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12655974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000000776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]
Predicted Effect probably benign
Transcript: ENSMUST00000000776
AA Change: S183P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 761 9.5e-124 PFAM
coiled coil region 787 814 N/A INTRINSIC
low complexity region 821 827 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164774
AA Change: S183P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 361 3.5e-16 PFAM
Predicted Effect silent
Transcript: ENSMUST00000165321
SMART Domains Protein: ENSMUSP00000131051
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
4933415A04Rik GTGT GTGTCTGT 11: 43,587,434 probably null Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,438 probably null Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Tubgcp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Tubgcp3 APN 8 12621809 missense probably benign 0.00
IGL00583:Tubgcp3 APN 8 12621906 nonsense probably null
IGL01289:Tubgcp3 APN 8 12639625 missense probably damaging 1.00
IGL01578:Tubgcp3 APN 8 12661297 splice site probably benign
IGL01716:Tubgcp3 APN 8 12641094 splice site probably benign
IGL01943:Tubgcp3 APN 8 12654301 missense probably damaging 1.00
IGL02020:Tubgcp3 APN 8 12637780 missense possibly damaging 0.46
IGL02345:Tubgcp3 APN 8 12625056 missense probably damaging 1.00
IGL02555:Tubgcp3 APN 8 12639595 missense probably benign 0.36
IGL02644:Tubgcp3 APN 8 12648733 missense probably damaging 1.00
IGL02976:Tubgcp3 APN 8 12632300 missense probably damaging 1.00
IGL03240:Tubgcp3 APN 8 12649797 missense probably benign 0.07
IGL03287:Tubgcp3 APN 8 12639630 missense possibly damaging 0.77
Tinky_winky UTSW 8 12650171 missense probably damaging 1.00
R0145:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R0379:Tubgcp3 UTSW 8 12641116 missense probably damaging 0.97
R0558:Tubgcp3 UTSW 8 12653462 missense probably benign 0.00
R1490:Tubgcp3 UTSW 8 12639550 missense probably damaging 1.00
R1709:Tubgcp3 UTSW 8 12639532 nonsense probably null
R1768:Tubgcp3 UTSW 8 12649686 unclassified probably benign
R1921:Tubgcp3 UTSW 8 12621932 nonsense probably null
R1928:Tubgcp3 UTSW 8 12663988 missense possibly damaging 0.94
R2161:Tubgcp3 UTSW 8 12632292 missense probably benign 0.22
R3120:Tubgcp3 UTSW 8 12657626 missense possibly damaging 0.51
R3434:Tubgcp3 UTSW 8 12658381 splice site probably null
R4011:Tubgcp3 UTSW 8 12639634 nonsense probably null
R4162:Tubgcp3 UTSW 8 12639547 missense possibly damaging 0.46
R4300:Tubgcp3 UTSW 8 12657600 missense probably damaging 0.99
R4350:Tubgcp3 UTSW 8 12641117 missense probably benign 0.19
R4529:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4530:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4531:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4676:Tubgcp3 UTSW 8 12650171 missense probably damaging 1.00
R4730:Tubgcp3 UTSW 8 12657654 missense probably benign 0.03
R4828:Tubgcp3 UTSW 8 12671987 missense probably benign
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R5610:Tubgcp3 UTSW 8 12639577 missense probably damaging 1.00
R5625:Tubgcp3 UTSW 8 12624888 missense possibly damaging 0.46
R5650:Tubgcp3 UTSW 8 12648670 missense probably damaging 0.98
R5775:Tubgcp3 UTSW 8 12625056 missense probably damaging 1.00
R6257:Tubgcp3 UTSW 8 12649835 splice site probably null
R6314:Tubgcp3 UTSW 8 12648625 missense probably benign 0.02
R6970:Tubgcp3 UTSW 8 12637000 missense probably damaging 0.98
R7173:Tubgcp3 UTSW 8 12639259 intron probably null
R7408:Tubgcp3 UTSW 8 12661359 nonsense probably null
R7502:Tubgcp3 UTSW 8 12641207 missense probably damaging 0.99
R7739:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGTGCTGGCTTCTAAATGAC -3'
(R):5'- GTCTGAAAACTGGGTCGGTG -3'

Sequencing Primer
(F):5'- GGTGCTGGCTTCTAAATGACAAAAC -3'
(R):5'- AAACTGGGTCGGTGTCCAG -3'
Posted On2019-11-12