Incidental Mutation 'R7701:Olfr967'
ID594006
Institutional Source Beutler Lab
Gene Symbol Olfr967
Ensembl Gene ENSMUSG00000055820
Gene Nameolfactory receptor 967
SynonymsGA_x6K02T2PVTD-33447884-33448816, MOR171-30P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7701 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39746249-39751493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39751301 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 305 (Y305C)
Ref Sequence ENSEMBL: ENSMUSP00000150183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069561] [ENSMUST00000213358]
Predicted Effect probably benign
Transcript: ENSMUST00000069561
AA Change: Y305C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064201
Gene: ENSMUSG00000055820
AA Change: Y305C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.6e-50 PFAM
Pfam:7tm_1 41 290 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213358
AA Change: Y305C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
4933415A04Rik GTGT GTGTCTGT 11: 43,587,434 probably null Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,438 probably null Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Olfr967
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Olfr967 APN 9 39750491 missense probably damaging 0.99
IGL02900:Olfr967 APN 9 39750605 missense probably benign 0.01
R0099:Olfr967 UTSW 9 39750661 missense possibly damaging 0.95
R0586:Olfr967 UTSW 9 39751118 missense probably damaging 0.98
R0653:Olfr967 UTSW 9 39750638 missense probably benign 0.26
R0839:Olfr967 UTSW 9 39750391 missense probably benign
R1701:Olfr967 UTSW 9 39751069 missense probably damaging 1.00
R1744:Olfr967 UTSW 9 39750415 missense probably benign 0.33
R1902:Olfr967 UTSW 9 39750806 missense probably benign 0.01
R4696:Olfr967 UTSW 9 39750728 missense probably damaging 0.98
R5252:Olfr967 UTSW 9 39750488 missense probably damaging 0.98
R5660:Olfr967 UTSW 9 39750767 missense probably damaging 1.00
R6272:Olfr967 UTSW 9 39750520 missense probably benign 0.39
R6976:Olfr967 UTSW 9 39751244 missense probably damaging 1.00
R7078:Olfr967 UTSW 9 39750491 missense possibly damaging 0.92
R7167:Olfr967 UTSW 9 39750569 missense probably damaging 0.96
R8026:Olfr967 UTSW 9 39750796 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGCAGCTCACACATATCAGCTG -3'
(R):5'- CTTGGCCTATGAGAATCTTTAAAGC -3'

Sequencing Primer
(F):5'- CTGTTGCTGTGTTCTTTGGGTC -3'
(R):5'- CCTGTACTGGGGCATATACAG -3'
Posted On2019-11-12