Incidental Mutation 'R7701:Spock1'
ID594024
Institutional Source Beutler Lab
Gene Symbol Spock1
Ensembl Gene ENSMUSG00000056222
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
Synonymstestican 1, Ticn1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7701 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location57421195-57908332 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57587659 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 103 (Q103*)
Ref Sequence ENSEMBL: ENSMUSP00000141130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172326] [ENSMUST00000185502] [ENSMUST00000185905] [ENSMUST00000186271] [ENSMUST00000187852] [ENSMUST00000189373]
Predicted Effect probably null
Transcript: ENSMUST00000172326
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000128840
Gene: ENSMUSG00000056222
AA Change: Q103*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 6e-35 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185502
AA Change: Q106*
SMART Domains Protein: ENSMUSP00000140409
Gene: ENSMUSG00000056222
AA Change: Q106*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 3.1e-33 PFAM
TY 337 383 9.64e-21 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185905
AA Change: Q103*
Predicted Effect probably null
Transcript: ENSMUST00000186271
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000140755
Gene: ENSMUSG00000056222
AA Change: Q103*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 3.1e-33 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187852
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000141130
Gene: ENSMUSG00000056222
AA Change: Q103*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 2.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189373
AA Change: Q106*
SMART Domains Protein: ENSMUSP00000139863
Gene: ENSMUSG00000056222
AA Change: Q106*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein core of a seminal plasma proteoglycan containing chondroitin- and heparan-sulfate chains. The protein's function is unknown, although similarity to thyropin-type cysteine protease-inhibitors suggests its function may be related to protease inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation display no obvious morphological or behavioral abnormalities, are fertile, and have normal life spans. Adult homozygotes exhibit normal brain morphology and EEG recordings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
4933415A04Rik GTGT GTGTCTGT 11: 43,587,434 probably null Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,438 probably null Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Spock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Spock1 APN 13 57587739 splice site probably benign
IGL00491:Spock1 APN 13 57556806 missense possibly damaging 0.67
IGL01942:Spock1 APN 13 57430328 missense probably damaging 1.00
IGL01998:Spock1 APN 13 57436181 splice site probably benign
IGL02428:Spock1 APN 13 57444432 splice site probably benign
IGL02805:Spock1 APN 13 57907577 missense possibly damaging 0.46
IGL02814:Spock1 APN 13 57587673 missense probably damaging 1.00
IGL03307:Spock1 APN 13 57429347 missense probably null 1.00
R0227:Spock1 UTSW 13 57440477 missense possibly damaging 0.86
R0243:Spock1 UTSW 13 57436109 critical splice donor site probably null
R0393:Spock1 UTSW 13 57440536 missense probably damaging 1.00
R1298:Spock1 UTSW 13 57512750 missense probably benign 0.00
R1393:Spock1 UTSW 13 57907454 missense probably damaging 1.00
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R2134:Spock1 UTSW 13 57436139 missense probably damaging 0.99
R4386:Spock1 UTSW 13 57440450 missense probably damaging 1.00
R5524:Spock1 UTSW 13 57556795 missense probably damaging 1.00
R5765:Spock1 UTSW 13 57429404 missense probably benign 0.19
R7195:Spock1 UTSW 13 57907502 missense possibly damaging 0.92
R7446:Spock1 UTSW 13 57436085 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCTGAGCTTGCAATCCG -3'
(R):5'- GGCACAAACATTCACAGCTG -3'

Sequencing Primer
(F):5'- GAGCTTGCAATCCGTGATCC -3'
(R):5'- CAAACATTCACAGCTGGTTTATTTCC -3'
Posted On2019-11-12