Incidental Mutation 'R7701:Pcdha8'
ID594030
Institutional Source Beutler Lab
Gene Symbol Pcdha8
Ensembl Gene ENSMUSG00000103800
Gene Nameprotocadherin alpha 8
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7701 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36992371-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36993811 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 449 (N449Y)
Ref Sequence ENSEMBL: ENSMUSP00000142159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably damaging
Transcript: ENSMUST00000194038
AA Change: N449Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800
AA Change: N449Y

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col24a1 A G 3: 145,366,901 probably null Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Flot2 A G 11: 78,038,116 probably null Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr1454 A G 19: 13,064,081 I223M probably damaging Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Smok2b A G 17: 13,234,880 probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp341 T A 2: 154,634,080 probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Pcdha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0751:Pcdha8 UTSW 18 36994070 missense probably damaging 0.98
R3416:Pcdha8 UTSW 18 36992630 missense probably benign 0.11
R3755:Pcdha8 UTSW 18 36993688 missense probably damaging 1.00
R3756:Pcdha8 UTSW 18 36993688 missense probably damaging 1.00
R3882:Pcdha8 UTSW 18 36993046 missense probably damaging 1.00
R3882:Pcdha8 UTSW 18 36993571 missense probably benign 0.08
R4036:Pcdha8 UTSW 18 36992861 missense probably benign
R4038:Pcdha8 UTSW 18 36992861 missense probably benign
R4204:Pcdha8 UTSW 18 36994684 missense probably damaging 1.00
R4246:Pcdha8 UTSW 18 36992897 missense probably damaging 1.00
R4596:Pcdha8 UTSW 18 36993558 missense possibly damaging 0.89
R4773:Pcdha8 UTSW 18 36994573 missense probably damaging 1.00
R5124:Pcdha8 UTSW 18 36993715 missense probably benign 0.09
R5396:Pcdha8 UTSW 18 36993734 missense probably damaging 0.98
R5435:Pcdha8 UTSW 18 36993599 missense probably damaging 1.00
R5562:Pcdha8 UTSW 18 36992971 missense possibly damaging 0.93
R5896:Pcdha8 UTSW 18 36993519 missense probably benign 0.01
R6277:Pcdha8 UTSW 18 36994358 missense probably damaging 0.98
R6415:Pcdha8 UTSW 18 36994561 missense probably damaging 1.00
R6620:Pcdha8 UTSW 18 36992528 missense probably benign 0.18
R6641:Pcdha8 UTSW 18 36993797 missense probably damaging 1.00
R6766:Pcdha8 UTSW 18 36994700 missense probably benign 0.00
R6807:Pcdha8 UTSW 18 36994348 missense probably damaging 0.99
R7120:Pcdha8 UTSW 18 36993787 missense possibly damaging 0.79
R7223:Pcdha8 UTSW 18 36993148 missense probably benign 0.04
R7358:Pcdha8 UTSW 18 36992777 missense probably damaging 1.00
R7712:Pcdha8 UTSW 18 36992684 missense possibly damaging 0.63
R7883:Pcdha8 UTSW 18 36993143 missense probably damaging 0.97
R7966:Pcdha8 UTSW 18 36993143 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACTCAGGTATCAACGGGCAG -3'
(R):5'- TGCACAGACACATAGCTCG -3'

Sequencing Primer
(F):5'- AGGTGACCTGCTCCTTGAC -3'
(R):5'- GATACTGTGAAGATGTGCG -3'
Posted On2019-11-12