Incidental Mutation 'R7701:Olfr1454'
ID594033
Institutional Source Beutler Lab
Gene Symbol Olfr1454
Ensembl Gene ENSMUSG00000094986
Gene Nameolfactory receptor 1454
SynonymsMOR202-14, GA_x6K02T2RE5P-3390804-3391727
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7701 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13060610-13067157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13064081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 223 (I223M)
Ref Sequence ENSEMBL: ENSMUSP00000150001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
Predicted Effect probably damaging
Transcript: ENSMUST00000073732
AA Change: I223M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: I223M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213806
AA Change: I223M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214695
AA Change: I223M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217568
AA Change: I223M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik T C 2: 170,601,305 probably benign Het
4932414N04Rik G A 2: 68,731,204 V292M possibly damaging Het
4933415A04Rik GTGT GTGTCTGT 11: 43,587,434 probably null Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,438 probably null Het
Actn1 A T 12: 80,174,554 V575E possibly damaging Het
Arhgef1 T C 7: 24,912,578 S129P probably benign Het
Aup1 T C 6: 83,055,927 V214A probably benign Het
AW822073 A G 10: 58,223,063 V623A possibly damaging Het
Bbs10 A G 10: 111,300,013 E329G probably damaging Het
Brinp2 A G 1: 158,266,460 probably null Het
Ccdc3 A G 2: 5,138,057 T42A possibly damaging Het
Cd276 T C 9: 58,535,527 N215S probably benign Het
Col24a1 T A 3: 145,315,011 M381K probably benign Het
Col6a4 A C 9: 106,082,888 F19V probably benign Het
Crybg1 G T 10: 43,989,143 A1446E probably benign Het
Dach1 C T 14: 97,903,234 R496K probably damaging Het
Dchs2 A G 3: 83,346,206 T2308A possibly damaging Het
Dync1h1 G A 12: 110,618,646 D828N probably damaging Het
Eif2a A T 3: 58,552,570 H462L possibly damaging Het
Gas2 T G 7: 51,993,353 Y263* probably null Het
Gm5111 A G 6: 48,590,093 I81V unknown Het
Iqcm A G 8: 75,554,911 I7M probably benign Het
Kank1 G A 19: 25,411,765 probably null Het
Lnx2 A T 5: 147,024,523 V533E probably damaging Het
Mapk8ip3 G T 17: 24,901,404 P904T possibly damaging Het
Mcm5 C A 8: 75,123,923 H596N probably benign Het
Miip A T 4: 147,862,914 V237E probably null Het
Mob3a G A 10: 80,689,934 A181V probably damaging Het
Mrpl38 G A 11: 116,135,278 R99W probably benign Het
Naa25 A G 5: 121,425,979 T486A probably benign Het
Olfr373 T A 8: 72,100,186 L142Q probably damaging Het
Olfr967 A G 9: 39,751,301 Y305C probably benign Het
Pcdha8 A T 18: 36,993,811 N449Y probably damaging Het
Pcdhb6 A T 18: 37,334,509 D161V probably damaging Het
Pdlim3 A G 8: 45,908,539 D134G probably benign Het
Phpt1 A G 2: 25,574,787 V18A probably benign Het
Prg4 T C 1: 150,457,542 K177E possibly damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Rab14 A G 2: 35,183,415 F150L Het
Rgs14 A G 13: 55,379,325 D169G probably damaging Het
Rreb1 C T 13: 37,930,116 L484F possibly damaging Het
Rsph14 A T 10: 74,957,776 Y264* probably null Het
Scly T C 1: 91,308,308 I152T Het
Ska1 A T 18: 74,202,643 H85Q probably damaging Het
Slc35b3 T C 13: 38,944,635 M159V probably benign Het
Spock1 G A 13: 57,587,659 Q103* probably null Het
Topbp1 T C 9: 103,332,985 V914A probably damaging Het
Tspan3 A T 9: 56,147,519 Y41* probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,729,684 I29458L possibly damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Zfat C A 15: 68,180,908 E346* probably null Het
Zfp54 A G 17: 21,434,095 T284A probably benign Het
Other mutations in Olfr1454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Olfr1454 APN 19 13064149 missense probably damaging 1.00
IGL02942:Olfr1454 APN 19 13064188 missense probably benign 0.45
IGL03331:Olfr1454 APN 19 13063867 missense probably damaging 1.00
R0551:Olfr1454 UTSW 19 13064294 missense probably benign 0.01
R0738:Olfr1454 UTSW 19 13063738 missense probably damaging 1.00
R1532:Olfr1454 UTSW 19 13064275 missense probably damaging 1.00
R2072:Olfr1454 UTSW 19 13063680 missense probably benign 0.00
R2092:Olfr1454 UTSW 19 13063802 nonsense probably null
R2656:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R2850:Olfr1454 UTSW 19 13063570 missense probably damaging 1.00
R4212:Olfr1454 UTSW 19 13063759 missense probably damaging 0.98
R5303:Olfr1454 UTSW 19 13063775 nonsense probably null
R6362:Olfr1454 UTSW 19 13063345 start gained probably benign
R6928:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R7183:Olfr1454 UTSW 19 13064316 missense probably benign 0.00
R7741:Olfr1454 UTSW 19 13064059 missense probably damaging 0.98
R8057:Olfr1454 UTSW 19 13063274 start gained probably benign
Z1176:Olfr1454 UTSW 19 13063646 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATATCTGTGGATTCCTCAATGCTTC -3'
(R):5'- ACATCGGGATGACCATGGTG -3'

Sequencing Primer
(F):5'- ACTGTAGATGCATTAAGTCTCTCC -3'
(R):5'- TCGGGATGACCATGGTGTAGAAC -3'
Posted On2019-11-12