Mutagenetix > Incidental Mutation

Incidental Mutation 'R7702:Ino80'

594041

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R7702 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119442573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 474 (D474G)

Ref Sequence

ENSEMBL: ENSMUSP00000106431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049920
AA Change: D474G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D474G

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110808
AA Change: D474G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: D474G

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,276,452		probably null	Het
AU040320	T	A	4: 126,814,373	S261T	probably benign	Het
Banp	T	A	8: 121,978,587	C65*	probably null	Het
Bloc1s5	T	C	13: 38,603,874	D178G	probably benign	Het
Cacna1c	A	G	6: 118,598,766	F1941L		Het
Cd48	A	G	1: 171,695,780	I64V	probably damaging	Het
Cela3a	A	G	4: 137,408,190	S21P	probably benign	Het
Cidec	A	G	6: 113,434,454	Y12H	possibly damaging	Het
Col12a1	C	G	9: 79,681,521	R1104T	probably damaging	Het
Ctsf	T	G	19: 4,856,539	F165V	probably damaging	Het
Cux2	T	C	5: 121,868,585	D874G	possibly damaging	Het
Dbnl	C	T	11: 5,798,048	L298F	probably benign	Het
Dnah1	C	A	14: 31,310,909	V390F	probably benign	Het
Dnah17	T	C	11: 118,025,640	I4236V	probably benign	Het
Dnah17	T	C	11: 118,121,478	D486G	possibly damaging	Het
Dpp6	T	A	5: 27,652,276	D406E	probably benign	Het
Dsp	C	T	13: 38,175,207	A318V	possibly damaging	Het
Duox1	T	C	2: 122,329,639	L745P	possibly damaging	Het
Ell	C	A	8: 70,539,714	A3E	possibly damaging	Het
Fer1l5	T	A	1: 36,420,694	L1832*	probably null	Het
Filip1	G	T	9: 79,820,649	N229K	probably benign	Het
Flg	A	T	3: 93,292,782	H195L	unknown	Het
Fndc7	G	T	3: 108,862,813	P685H	probably damaging	Het
Ggt1	A	G	10: 75,576,282	N120S	probably benign	Het
Gm4952	A	T	19: 12,627,064	H280L	probably benign	Het
Gm6583	T	C	5: 112,355,197	K214E	probably benign	Het
Golim4	A	T	3: 75,886,784	D551E	probably damaging	Het
Hist2h3b	C	A	3: 96,268,993	Y100*	probably null	Het
Hmbs	A	C	9: 44,336,850		probably null	Het
Ipo4	A	C	14: 55,632,330	H343Q	probably damaging	Het
Jade2	C	T	11: 51,816,917	R823H	probably damaging	Het
Jakmip1	C	T	5: 37,117,497	T453I	probably damaging	Het
Klk6	T	C	7: 43,829,265	S199P	probably damaging	Het
Ltn1	A	T	16: 87,426,278	Y105N	probably damaging	Het
Map3k19	G	T	1: 127,829,090	T394N	probably damaging	Het
Megf6	G	A	4: 154,270,470	D1445N	probably benign	Het
Mmp21	A	G	7: 133,679,062	Y60H	probably damaging	Het
Mylk4	C	T	13: 32,720,602		probably null	Het
Nckipsd	A	T	9: 108,814,017	R38*	probably null	Het
Nob1	G	A	8: 107,413,105	R341*	probably null	Het
Olfr204	A	G	16: 59,314,634	Y258H	probably damaging	Het
Olfr378	T	A	11: 73,433,349		probably benign	Het
Olfr741	A	G	14: 50,486,294	T279A	possibly damaging	Het
Pcdh1	A	G	18: 38,203,516	L22P	unknown	Het
Pebp4	T	A	14: 70,059,607	N198K	probably benign	Het
Pkp4	T	C	2: 59,308,413	S336P	probably damaging	Het
Prr5l	T	A	2: 101,717,097	D361V	probably benign	Het
Ralgapa1	C	G	12: 55,709,555	V1086L	probably damaging	Het
Ralgapa1	T	A	12: 55,709,556	Q1085H	probably damaging	Het
Ryr2	T	C	13: 11,690,333	N2849S	probably damaging	Het
Slc6a18	A	T	13: 73,672,796	L223H	probably damaging	Het
Sqstm1	T	G	11: 50,206,105		probably null	Het
Syne1	T	C	10: 5,245,835	E3945G	probably damaging	Het
Syne2	A	G	12: 75,990,387	Y3780C	probably benign	Het
Tecpr1	A	G	5: 144,203,418	Y840H	probably damaging	Het
Tmem183a	T	C	1: 134,360,801	Q108R	probably benign	Het
Tmtc1	A	T	6: 148,443,917	C95S	probably benign	Het
Trappc8	C	T	18: 20,825,062	V1250I	probably damaging	Het
Tshz1	A	G	18: 84,014,336	V649A	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Vmn1r123	A	C	7: 21,162,377	T65P	probably damaging	Het
Vmn2r63	A	T	7: 42,928,129	H328Q	possibly damaging	Het
Zeb1	T	C	18: 5,766,802	S438P	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCATGCCTTTCAGCTGG -3'
(R):5'- CATAGTCTCCTATGTACCCAAACTC -3'

Sequencing Primer
(F):5'- AGCTGGTAACCTTTCAACTTGC -3'
(R):5'- TAGTGAGCAACATAGCTTAGTATGG -3'

Posted On

2019-11-12