Incidental Mutation 'R7702:Ino80'
ID 594041
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene Name INO80 complex subunit
Synonyms INO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R7702 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119373042-119477687 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119442573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 474 (D474G)
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
AlphaFold Q6ZPV2
Predicted Effect possibly damaging
Transcript: ENSMUST00000049920
AA Change: D474G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D474G

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110808
AA Change: D474G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: D474G

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Fndc7 G T 3: 108,862,813 P685H probably damaging Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Olfr741 A G 14: 50,486,294 T279A possibly damaging Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Slc6a18 A T 13: 73,672,796 L223H probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r123 A C 7: 21,162,377 T65P probably damaging Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
Chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7975:Ino80 UTSW 2 119456467 splice site probably null
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593 missense probably benign
R8720:Ino80 UTSW 2 119402387 missense probably damaging 1.00
R8751:Ino80 UTSW 2 119406908 missense probably benign
R8958:Ino80 UTSW 2 119383381 missense probably damaging 1.00
R8992:Ino80 UTSW 2 119379578 missense possibly damaging 0.93
R9319:Ino80 UTSW 2 119374524 missense probably benign 0.13
R9346:Ino80 UTSW 2 119426958 missense possibly damaging 0.54
R9370:Ino80 UTSW 2 119402367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCATGCCTTTCAGCTGG -3'
(R):5'- CATAGTCTCCTATGTACCCAAACTC -3'

Sequencing Primer
(F):5'- AGCTGGTAACCTTTCAACTTGC -3'
(R):5'- TAGTGAGCAACATAGCTTAGTATGG -3'
Posted On 2019-11-12