Incidental Mutation 'R7702:Fndc7'
ID 594046
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Name fibronectin type III domain containing 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7702 (G1)
Quality Score 205.009
Status Validated
Chromosome 3
Chromosomal Location 108853678-108890008 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108862813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 685 (P685H)
Ref Sequence ENSEMBL: ENSMUSP00000099680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
AlphaFold A2AED3
Predicted Effect probably damaging
Transcript: ENSMUST00000053065
AA Change: P599H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326
AA Change: P599H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102620
AA Change: P685H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: P685H

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180063
AA Change: P685H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: P685H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ino80 T C 2: 119,442,573 D474G probably benign Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Olfr741 A G 14: 50,486,294 T279A possibly damaging Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Slc6a18 A T 13: 73,672,796 L223H probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r123 A C 7: 21,162,377 T65P probably damaging Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108883468 missense probably benign 0.17
IGL02823:Fndc7 APN 3 108869171 missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108862931 missense probably benign 0.04
IGL03196:Fndc7 APN 3 108883444 missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108867308 missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108876532 missense probably benign 0.12
R0240:Fndc7 UTSW 3 108858919 splice site probably benign
R0324:Fndc7 UTSW 3 108876699 splice site probably null
R0457:Fndc7 UTSW 3 108876545 missense probably benign 0.02
R0630:Fndc7 UTSW 3 108876615 missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108870588 missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108869330 missense probably benign 0.14
R1772:Fndc7 UTSW 3 108870534 missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108876687 missense probably benign 0.00
R1957:Fndc7 UTSW 3 108883509 missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108869148 missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108858902 missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4652:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4791:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R4933:Fndc7 UTSW 3 108876670 missense probably benign 0.01
R5004:Fndc7 UTSW 3 108883473 missense probably damaging 1.00
R5042:Fndc7 UTSW 3 108862786 missense probably damaging 1.00
R5054:Fndc7 UTSW 3 108881347 missense probably damaging 0.97
R5175:Fndc7 UTSW 3 108869166 missense probably benign 0.04
R5325:Fndc7 UTSW 3 108883449 missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108856408 missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108862892 missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108881391 missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108870575 missense probably damaging 0.99
R6737:Fndc7 UTSW 3 108872278 missense probably damaging 1.00
R6993:Fndc7 UTSW 3 108876591 missense probably benign 0.00
R6998:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R6999:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7000:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7001:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7181:Fndc7 UTSW 3 108881324 critical splice donor site probably null
R7324:Fndc7 UTSW 3 108872221 missense probably benign 0.06
R7425:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R7631:Fndc7 UTSW 3 108869252 missense probably damaging 1.00
R7713:Fndc7 UTSW 3 108870663 missense possibly damaging 0.90
R7909:Fndc7 UTSW 3 108862916 missense probably benign 0.04
R7946:Fndc7 UTSW 3 108872136 missense possibly damaging 0.78
R8023:Fndc7 UTSW 3 108867145 missense probably damaging 1.00
R8694:Fndc7 UTSW 3 108872306 nonsense probably null
R8708:Fndc7 UTSW 3 108867212 missense probably benign 0.00
R9325:Fndc7 UTSW 3 108883518 missense possibly damaging 0.55
Z1088:Fndc7 UTSW 3 108883500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGGAACTCTGTAGACCAG -3'
(R):5'- ATAGGTGTCTGTTGCCCAC -3'

Sequencing Primer
(F):5'- AACTCTGTAGACCAGGCTGG -3'
(R):5'- CCACTGGGGGTCAAATTATATAGGC -3'
Posted On 2019-11-12