Incidental Mutation 'R7702:Vmn1r123'
ID594059
Institutional Source Beutler Lab
Gene Symbol Vmn1r123
Ensembl Gene ENSMUSG00000094385
Gene Namevomeronasal 1 receptor 123
SynonymsGm1446, LOC384695
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7702 (G1)
Quality Score211.009
Status Not validated
Chromosome7
Chromosomal Location21162185-21163108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21162377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 65 (T65P)
Ref Sequence ENSEMBL: ENSMUSP00000125823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166948]
Predicted Effect probably damaging
Transcript: ENSMUST00000166948
AA Change: T65P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125823
Gene: ENSMUSG00000094385
AA Change: T65P

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 7e-18 PFAM
Pfam:7tm_1 31 291 2.1e-8 PFAM
Pfam:V1R 41 298 1.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Fndc7 G T 3: 108,862,813 P685H probably damaging Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ino80 T C 2: 119,442,573 D474G probably benign Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Olfr741 A G 14: 50,486,294 T279A possibly damaging Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Slc6a18 A T 13: 73,672,796 L223H probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Vmn1r123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Vmn1r123 APN 7 21162291 missense possibly damaging 0.93
IGL02330:Vmn1r123 APN 7 21163044 missense probably damaging 0.99
IGL02742:Vmn1r123 APN 7 21163043 missense possibly damaging 0.93
IGL03240:Vmn1r123 APN 7 21162357 missense possibly damaging 0.94
R1173:Vmn1r123 UTSW 7 21162332 missense probably damaging 0.99
R6278:Vmn1r123 UTSW 7 21162849 missense possibly damaging 0.78
R6610:Vmn1r123 UTSW 7 21162590 missense probably benign 0.00
R6679:Vmn1r123 UTSW 7 21162943 nonsense probably null
R7241:Vmn1r123 UTSW 7 21162612 missense possibly damaging 0.95
R7642:Vmn1r123 UTSW 7 21162870 missense probably benign 0.11
R7870:Vmn1r123 UTSW 7 21162267 missense probably damaging 1.00
R7981:Vmn1r123 UTSW 7 21162989 missense probably damaging 0.98
R8554:Vmn1r123 UTSW 7 21163046 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACTGTAGGATTGGGAAAAGCC -3'
(R):5'- CCTCTATTAACAGGAACAAGAGTGAC -3'

Sequencing Primer
(F):5'- GGAAAAGCCCTCTCCATGTCTG -3'
(R):5'- TGACAAACTGATGGATACTCAGGAC -3'
Posted On2019-11-12