Incidental Mutation 'R7702:Nckipsd'
ID 594068
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission 045763-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R7702 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 108691216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 38 (R38*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect silent
Transcript: ENSMUST00000035218
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192678
AA Change: R38*
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,167,278 (GRCm39) probably null Het
AU040320 T A 4: 126,708,166 (GRCm39) S261T probably benign Het
Banp T A 8: 122,705,326 (GRCm39) C65* probably null Het
Bloc1s5 T C 13: 38,787,850 (GRCm39) D178G probably benign Het
Cacna1c A G 6: 118,575,727 (GRCm39) F1941L Het
Ccdc121rt3 T C 5: 112,503,063 (GRCm39) K214E probably benign Het
Cd48 A G 1: 171,523,348 (GRCm39) I64V probably damaging Het
Cela3a A G 4: 137,135,501 (GRCm39) S21P probably benign Het
Cidec A G 6: 113,411,415 (GRCm39) Y12H possibly damaging Het
Col12a1 C G 9: 79,588,803 (GRCm39) R1104T probably damaging Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dbnl C T 11: 5,748,048 (GRCm39) L298F probably benign Het
Dnah1 C A 14: 31,032,866 (GRCm39) V390F probably benign Het
Dnah17 T C 11: 118,012,304 (GRCm39) D486G possibly damaging Het
Dnah17 T C 11: 117,916,466 (GRCm39) I4236V probably benign Het
Dpp6 T A 5: 27,857,274 (GRCm39) D406E probably benign Het
Dsp C T 13: 38,359,183 (GRCm39) A318V possibly damaging Het
Duox1 T C 2: 122,160,120 (GRCm39) L745P possibly damaging Het
Ell C A 8: 70,992,364 (GRCm39) A3E possibly damaging Het
Fer1l5 T A 1: 36,459,775 (GRCm39) L1832* probably null Het
Filip1 G T 9: 79,727,931 (GRCm39) N229K probably benign Het
Flg A T 3: 93,200,089 (GRCm39) H195L unknown Het
Fndc7 G T 3: 108,770,129 (GRCm39) P685H probably damaging Het
Ggt1 A G 10: 75,412,116 (GRCm39) N120S probably benign Het
Gm4952 A T 19: 12,604,428 (GRCm39) H280L probably benign Het
Golim4 A T 3: 75,794,091 (GRCm39) D551E probably damaging Het
H3c13 C A 3: 96,176,309 (GRCm39) Y100* probably null Het
Hmbs A C 9: 44,248,147 (GRCm39) probably null Het
Ino80 T C 2: 119,273,054 (GRCm39) D474G probably benign Het
Ipo4 A C 14: 55,869,787 (GRCm39) H343Q probably damaging Het
Jade2 C T 11: 51,707,744 (GRCm39) R823H probably damaging Het
Jakmip1 C T 5: 37,274,841 (GRCm39) T453I probably damaging Het
Klk6 T C 7: 43,478,689 (GRCm39) S199P probably damaging Het
Ltn1 A T 16: 87,223,166 (GRCm39) Y105N probably damaging Het
Map3k19 G T 1: 127,756,827 (GRCm39) T394N probably damaging Het
Megf6 G A 4: 154,354,927 (GRCm39) D1445N probably benign Het
Mmp21 A G 7: 133,280,791 (GRCm39) Y60H probably damaging Het
Mylk4 C T 13: 32,904,585 (GRCm39) probably null Het
Nob1 G A 8: 108,139,737 (GRCm39) R341* probably null Het
Or11g25 A G 14: 50,723,751 (GRCm39) T279A possibly damaging Het
Or1e19 T A 11: 73,324,175 (GRCm39) probably benign Het
Or5ac22 A G 16: 59,134,997 (GRCm39) Y258H probably damaging Het
Pcdh1 A G 18: 38,336,569 (GRCm39) L22P unknown Het
Pebp4 T A 14: 70,297,056 (GRCm39) N198K probably benign Het
Pkp4 T C 2: 59,138,757 (GRCm39) S336P probably damaging Het
Prr5l T A 2: 101,547,442 (GRCm39) D361V probably benign Het
Ralgapa1 C G 12: 55,756,340 (GRCm39) V1086L probably damaging Het
Ralgapa1 T A 12: 55,756,341 (GRCm39) Q1085H probably damaging Het
Ryr2 T C 13: 11,705,219 (GRCm39) N2849S probably damaging Het
Slc6a18 A T 13: 73,820,915 (GRCm39) L223H probably damaging Het
Sqstm1 T G 11: 50,096,932 (GRCm39) probably null Het
Syne1 T C 10: 5,195,835 (GRCm39) E3945G probably damaging Het
Syne2 A G 12: 76,037,161 (GRCm39) Y3780C probably benign Het
Tecpr1 A G 5: 144,140,236 (GRCm39) Y840H probably damaging Het
Tmem183a T C 1: 134,288,539 (GRCm39) Q108R probably benign Het
Tmtc1 A T 6: 148,345,415 (GRCm39) C95S probably benign Het
Trappc8 C T 18: 20,958,119 (GRCm39) V1250I probably damaging Het
Tshz1 A G 18: 84,032,461 (GRCm39) V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Vmn1r123 A C 7: 20,896,302 (GRCm39) T65P probably damaging Het
Vmn2r63 A T 7: 42,577,553 (GRCm39) H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 (GRCm39) S438P probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTGGAGTTGGCCTACACAG -3'
(R):5'- GTGACCTAATGGCTGAAGGG -3'

Sequencing Primer
(F):5'- TGTGGGACCTCAGTTCAAAG -3'
(R):5'- CCTAATGGCTGAAGGGTGATG -3'
Posted On 2019-11-12