Incidental Mutation 'R7702:Slc6a18'
ID 594084
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Name solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms Xtrp2, D630001K16Rik, XT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7702 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 73661752-73678023 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73672796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 223 (L223H)
Ref Sequence ENSEMBL: ENSMUSP00000152525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
AlphaFold O88576
Predicted Effect probably damaging
Transcript: ENSMUST00000022105
AA Change: L223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: L223H

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109679
AA Change: L223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: L223H

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109680
AA Change: L223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: L223H

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220650
AA Change: L223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221026
Predicted Effect probably benign
Transcript: ENSMUST00000221987
Predicted Effect probably damaging
Transcript: ENSMUST00000222029
AA Change: L223H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223026
AA Change: L223H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223074
AA Change: L223H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Fndc7 G T 3: 108,862,813 P685H probably damaging Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ino80 T C 2: 119,442,573 D474G probably benign Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Olfr741 A G 14: 50,486,294 T279A possibly damaging Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r123 A C 7: 21,162,377 T65P probably damaging Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
R8039:Slc6a18 UTSW 13 73665626 missense probably benign 0.39
R8423:Slc6a18 UTSW 13 73665574 missense probably benign 0.00
R8669:Slc6a18 UTSW 13 73664311 missense probably benign 0.01
R8825:Slc6a18 UTSW 13 73665632 missense probably null 0.01
R8993:Slc6a18 UTSW 13 73668271 missense probably benign 0.01
R9023:Slc6a18 UTSW 13 73675770 missense probably damaging 1.00
R9031:Slc6a18 UTSW 13 73671703 missense possibly damaging 0.56
R9589:Slc6a18 UTSW 13 73668204 missense not run
Z1177:Slc6a18 UTSW 13 73677860 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGATCAAGGTATTGCATGCTAC -3'
(R):5'- ATGAACCTGACCTTGCCCTG -3'

Sequencing Primer
(F):5'- CAAGGTATTGCATGCTACGATGCC -3'
(R):5'- GACCTTGCCCTGACCTCAC -3'
Posted On 2019-11-12