Incidental Mutation 'R7702:Olfr741'
ID594086
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7702 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50486294 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 279 (T279A)
Ref Sequence ENSEMBL: ENSMUSP00000145848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518] [ENSMUST00000213903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071932
AA Change: T279A

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: T279A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205518
AA Change: T279A

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213903
AA Change: T279A

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Fndc7 G T 3: 108,862,813 P685H probably damaging Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ino80 T C 2: 119,442,573 D474G probably benign Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Slc6a18 A T 13: 73,672,796 L223H probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r123 A C 7: 21,162,377 T65P probably damaging Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
PIT4515001:Olfr741 UTSW 14 50486079 missense probably benign 0.03
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2270:Olfr741 UTSW 14 50486037 missense probably damaging 1.00
R2338:Olfr741 UTSW 14 50485640 missense possibly damaging 0.47
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R8169:Olfr741 UTSW 14 50486235 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TACATATTGGTCCTAAGAGCTGTG -3'
(R):5'- GGGAGTACAGTATTTGACTTCCC -3'

Sequencing Primer
(F):5'- AGCTGTGTTTAGACTTCCTTCAAGAG -3'
(R):5'- GAGTACAGTATTTGACTTCCCATAAC -3'
Posted On2019-11-12