Incidental Mutation 'R7702:Ctsf'
ID594095
Institutional Source Beutler Lab
Gene Symbol Ctsf
Ensembl Gene ENSMUSG00000083282
Gene Namecathepsin F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7702 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4855129-4860912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4856539 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 165 (F165V)
Ref Sequence ENSEMBL: ENSMUSP00000112481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Meta Mutation Damage Score 0.8977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,276,452 probably null Het
AU040320 T A 4: 126,814,373 S261T probably benign Het
Banp T A 8: 121,978,587 C65* probably null Het
Bloc1s5 T C 13: 38,603,874 D178G probably benign Het
Cacna1c A G 6: 118,598,766 F1941L Het
Cd48 A G 1: 171,695,780 I64V probably damaging Het
Cela3a A G 4: 137,408,190 S21P probably benign Het
Cidec A G 6: 113,434,454 Y12H possibly damaging Het
Col12a1 C G 9: 79,681,521 R1104T probably damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dbnl C T 11: 5,798,048 L298F probably benign Het
Dnah1 C A 14: 31,310,909 V390F probably benign Het
Dnah17 T C 11: 118,025,640 I4236V probably benign Het
Dnah17 T C 11: 118,121,478 D486G possibly damaging Het
Dpp6 T A 5: 27,652,276 D406E probably benign Het
Dsp C T 13: 38,175,207 A318V possibly damaging Het
Duox1 T C 2: 122,329,639 L745P possibly damaging Het
Ell C A 8: 70,539,714 A3E possibly damaging Het
Fer1l5 T A 1: 36,420,694 L1832* probably null Het
Filip1 G T 9: 79,820,649 N229K probably benign Het
Flg A T 3: 93,292,782 H195L unknown Het
Fndc7 G T 3: 108,862,813 P685H probably damaging Het
Ggt1 A G 10: 75,576,282 N120S probably benign Het
Gm4952 A T 19: 12,627,064 H280L probably benign Het
Gm6583 T C 5: 112,355,197 K214E probably benign Het
Golim4 A T 3: 75,886,784 D551E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmbs A C 9: 44,336,850 probably null Het
Ino80 T C 2: 119,442,573 D474G probably benign Het
Ipo4 A C 14: 55,632,330 H343Q probably damaging Het
Jade2 C T 11: 51,816,917 R823H probably damaging Het
Jakmip1 C T 5: 37,117,497 T453I probably damaging Het
Klk6 T C 7: 43,829,265 S199P probably damaging Het
Ltn1 A T 16: 87,426,278 Y105N probably damaging Het
Map3k19 G T 1: 127,829,090 T394N probably damaging Het
Megf6 G A 4: 154,270,470 D1445N probably benign Het
Mmp21 A G 7: 133,679,062 Y60H probably damaging Het
Mylk4 C T 13: 32,720,602 probably null Het
Nckipsd A T 9: 108,814,017 R38* probably null Het
Nob1 G A 8: 107,413,105 R341* probably null Het
Olfr204 A G 16: 59,314,634 Y258H probably damaging Het
Olfr378 T A 11: 73,433,349 probably benign Het
Olfr741 A G 14: 50,486,294 T279A possibly damaging Het
Pcdh1 A G 18: 38,203,516 L22P unknown Het
Pebp4 T A 14: 70,059,607 N198K probably benign Het
Pkp4 T C 2: 59,308,413 S336P probably damaging Het
Prr5l T A 2: 101,717,097 D361V probably benign Het
Ralgapa1 C G 12: 55,709,555 V1086L probably damaging Het
Ralgapa1 T A 12: 55,709,556 Q1085H probably damaging Het
Ryr2 T C 13: 11,690,333 N2849S probably damaging Het
Slc6a18 A T 13: 73,672,796 L223H probably damaging Het
Sqstm1 T G 11: 50,206,105 probably null Het
Syne1 T C 10: 5,245,835 E3945G probably damaging Het
Syne2 A G 12: 75,990,387 Y3780C probably benign Het
Tecpr1 A G 5: 144,203,418 Y840H probably damaging Het
Tmem183a T C 1: 134,360,801 Q108R probably benign Het
Tmtc1 A T 6: 148,443,917 C95S probably benign Het
Trappc8 C T 18: 20,825,062 V1250I probably damaging Het
Tshz1 A G 18: 84,014,336 V649A probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r123 A C 7: 21,162,377 T65P probably damaging Het
Vmn2r63 A T 7: 42,928,129 H328Q possibly damaging Het
Zeb1 T C 18: 5,766,802 S438P probably damaging Het
Other mutations in Ctsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ctsf APN 19 4858078 missense probably damaging 1.00
IGL01891:Ctsf APN 19 4856567 missense probably damaging 0.99
IGL03291:Ctsf APN 19 4859634 missense probably benign 0.00
R0587:Ctsf UTSW 19 4855738 missense probably benign 0.35
R0831:Ctsf UTSW 19 4859840 missense possibly damaging 0.92
R1808:Ctsf UTSW 19 4856534 missense probably benign 0.00
R5652:Ctsf UTSW 19 4858477 missense probably damaging 1.00
R5662:Ctsf UTSW 19 4856578 missense probably damaging 0.98
R6993:Ctsf UTSW 19 4858483 missense probably benign 0.45
R7703:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7704:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7705:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7962:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7965:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7966:Ctsf UTSW 19 4856539 missense probably damaging 1.00
RF012:Ctsf UTSW 19 4858666 missense probably benign 0.05
Z1176:Ctsf UTSW 19 4856306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGACAAAGGCCCCTTAATC -3'
(R):5'- CTAGGGATATGGGCTCCTTGAG -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'
Posted On2019-11-12