Incidental Mutation 'R7703:Baz2b'
ID594100
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59917425 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1298 (R1298L)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect probably damaging
Transcript: ENSMUST00000090925
AA Change: R1298L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: R1298L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112550
AA Change: R1298L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: R1298L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 unclassified probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 intron probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7933:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7934:Baz2b UTSW 2 59936716 missense probably damaging 0.98
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGAAGGTAGCTTCAGGAG -3'
(R):5'- ATTGGGAATGCAACGTTTCTC -3'

Sequencing Primer
(F):5'- TGGGGACTGAATATTCACTATACTC -3'
(R):5'- GGGAATGCAACGTTTCTCCCTTTG -3'
Posted On2019-11-12