Incidental Mutation 'R7703:Rapgef4'
ID594101
Institutional Source Beutler Lab
Gene Symbol Rapgef4
Ensembl Gene ENSMUSG00000049044
Gene NameRap guanine nucleotide exchange factor (GEF) 4
SynonymscAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71981240-72257474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72179971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 291 (D291G)
Ref Sequence ENSEMBL: ENSMUSP00000088336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]
PDB Structure
CRYSTAL STRUCTURE OF THE REGULATORY DOMAIN OF EPAC2 [X-RAY DIFFRACTION]
STRUCTURE OF THE CAMP RESPONSIVE EXCHANGE FACTOR EPAC2 IN ITS AUTO-INHIBITED STATE [X-RAY DIFFRACTION]
Structure of Epac2 in complex with cyclic-AMP and Rap [X-RAY DIFFRACTION]
Conformational dynamics of exchange protein directly activated by cAMP [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028525
AA Change: D147G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: D147G

DomainStartEndE-ValueType
DEP 72 147 3.43e-27 SMART
low complexity region 158 167 N/A INTRINSIC
cNMP 212 331 4.02e-15 SMART
RasGEFN 351 486 3.61e-7 SMART
Blast:RasGEF 534 607 1e-33 BLAST
RasGEF 624 866 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090826
AA Change: D291G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: D291G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 216 291 3.43e-27 SMART
low complexity region 302 311 N/A INTRINSIC
cNMP 356 475 4.02e-15 SMART
RasGEFN 495 630 3.61e-7 SMART
Blast:RasGEF 678 751 2e-33 BLAST
RasGEF 768 1010 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102698
AA Change: D273G

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: D273G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 198 273 3.43e-27 SMART
low complexity region 284 293 N/A INTRINSIC
cNMP 338 457 4.02e-15 SMART
RasGEFN 477 612 3.61e-7 SMART
Blast:RasGEF 660 733 2e-33 BLAST
RasGEF 750 992 8.09e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Rapgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rapgef4 APN 2 72256312 missense possibly damaging 0.75
IGL00858:Rapgef4 APN 2 72198897 missense probably damaging 1.00
IGL01408:Rapgef4 APN 2 72174841 nonsense probably null
IGL01673:Rapgef4 APN 2 72241437 missense probably damaging 0.99
IGL01678:Rapgef4 APN 2 72242225 splice site probably benign
IGL01725:Rapgef4 APN 2 72174874 missense probably benign 0.24
IGL01871:Rapgef4 APN 2 72198360 missense possibly damaging 0.69
IGL01935:Rapgef4 APN 2 72234123 missense probably benign 0.05
IGL02001:Rapgef4 APN 2 72225052 splice site probably benign
IGL02041:Rapgef4 APN 2 72198796 missense probably damaging 1.00
IGL02134:Rapgef4 APN 2 72180061 missense probably damaging 0.97
IGL02410:Rapgef4 APN 2 72226594 missense possibly damaging 0.51
IGL02807:Rapgef4 APN 2 72205649 splice site probably benign
IGL03066:Rapgef4 APN 2 72141179 splice site probably benign
IGL03282:Rapgef4 APN 2 72205752 splice site probably benign
IGL03291:Rapgef4 APN 2 72195703 missense probably damaging 1.00
P0033:Rapgef4 UTSW 2 72137331 intron probably benign
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0309:Rapgef4 UTSW 2 72226030 missense probably benign 0.02
R0398:Rapgef4 UTSW 2 72031041 missense probably damaging 0.99
R0747:Rapgef4 UTSW 2 72223073 missense possibly damaging 0.66
R1216:Rapgef4 UTSW 2 72208148 missense possibly damaging 0.51
R1264:Rapgef4 UTSW 2 72031105 missense possibly damaging 0.48
R1302:Rapgef4 UTSW 2 72045160 missense probably benign 0.31
R1460:Rapgef4 UTSW 2 72031176 critical splice donor site probably null
R1483:Rapgef4 UTSW 2 72055026 critical splice donor site probably null
R1682:Rapgef4 UTSW 2 72226568 missense possibly damaging 0.80
R1768:Rapgef4 UTSW 2 72225787 splice site probably benign
R1858:Rapgef4 UTSW 2 72031064 missense possibly damaging 0.67
R1860:Rapgef4 UTSW 2 72234720 missense probably benign 0.05
R1952:Rapgef4 UTSW 2 72208127 missense probably benign 0.07
R2025:Rapgef4 UTSW 2 72242739 missense probably benign 0.01
R2128:Rapgef4 UTSW 2 72226553 missense possibly damaging 0.87
R2159:Rapgef4 UTSW 2 72174881 missense probably damaging 1.00
R2201:Rapgef4 UTSW 2 72045189 missense probably damaging 0.96
R2883:Rapgef4 UTSW 2 72031125 missense probably benign
R3015:Rapgef4 UTSW 2 72198373 missense probably damaging 1.00
R4278:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R5256:Rapgef4 UTSW 2 72034034 missense probably damaging 0.97
R5572:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5574:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5575:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5749:Rapgef4 UTSW 2 72242757 missense probably damaging 1.00
R6007:Rapgef4 UTSW 2 72179949 missense possibly damaging 0.55
R6084:Rapgef4 UTSW 2 72196278 critical splice donor site probably null
R6192:Rapgef4 UTSW 2 71981317 missense probably benign 0.00
R6409:Rapgef4 UTSW 2 72178237 missense probably benign 0.01
R6683:Rapgef4 UTSW 2 72054779 intron probably benign
R6774:Rapgef4 UTSW 2 72225775 missense probably benign 0.01
R6844:Rapgef4 UTSW 2 72234626 missense probably damaging 0.99
R6999:Rapgef4 UTSW 2 72239125 missense probably damaging 1.00
R7077:Rapgef4 UTSW 2 72241476 missense probably damaging 0.96
R7138:Rapgef4 UTSW 2 72198363 missense probably damaging 1.00
R7275:Rapgef4 UTSW 2 72208101 missense probably damaging 1.00
R7352:Rapgef4 UTSW 2 72180091 missense probably damaging 1.00
R7397:Rapgef4 UTSW 2 72205666 missense probably benign 0.23
R7508:Rapgef4 UTSW 2 72205733 missense probably benign 0.00
R7620:Rapgef4 UTSW 2 72229078 missense probably damaging 0.99
R7770:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R7814:Rapgef4 UTSW 2 72223117 missense probably benign
R7868:Rapgef4 UTSW 2 72201137 missense probably benign 0.11
R7951:Rapgef4 UTSW 2 72201137 missense probably benign 0.11
X0062:Rapgef4 UTSW 2 72226607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGACTCTGACTCTGCTGTTAG -3'
(R):5'- GGGAAGACCAGGACTTTTGC -3'

Sequencing Primer
(F):5'- AGCTGCACAACTCTTGTCAG -3'
(R):5'- GACCAGGACTTTTGCTGCCTTG -3'
Posted On2019-11-12