Incidental Mutation 'R7703:Rbpj'
ID594109
Institutional Source Beutler Lab
Gene Symbol Rbpj
Ensembl Gene ENSMUSG00000039191
Gene Namerecombination signal binding protein for immunoglobulin kappa J region
SynonymsRBP-J kappa, CBF1, Igkjrb, RBPjk, Igkrsbp, Rbpsuh
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53466152-53657362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53645898 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 156 (I156T)
Ref Sequence ENSEMBL: ENSMUSP00000040694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037618] [ENSMUST00000087360] [ENSMUST00000113865] [ENSMUST00000201883] [ENSMUST00000201912] [ENSMUST00000201991]
PDB Structure
CSL (RBP-Jk) bound to DNA [X-RAY DIFFRACTION]
CSL (RBP-Jk) bound to HES-1 nonconsensus site [X-RAY DIFFRACTION]
CSL (RBP-Jk) with corepressor KyoT2 bound to DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000037618
AA Change: I156T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040694
Gene: ENSMUSG00000039191
AA Change: I156T

DomainStartEndE-ValueType
LAG1_DNAbind 73 204 2.97e-86 SMART
BTD 205 354 8.01e-92 SMART
SCOP:d1a02n1 380 472 8e-29 SMART
low complexity region 508 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087360
AA Change: I115T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084618
Gene: ENSMUSG00000039191
AA Change: I115T

DomainStartEndE-ValueType
LAG1_DNAbind 32 163 2.97e-86 SMART
BTD 164 313 8.01e-92 SMART
Pfam:TIG 340 429 3.6e-9 PFAM
low complexity region 467 485 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113865
AA Change: I117T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109496
Gene: ENSMUSG00000039191
AA Change: I117T

DomainStartEndE-ValueType
LAG1_DNAbind 34 165 2.97e-86 SMART
BTD 166 315 8.01e-92 SMART
Pfam:TIG 342 431 6.1e-9 PFAM
low complexity region 469 487 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201883
AA Change: I95T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143846
Gene: ENSMUSG00000039191
AA Change: I95T

DomainStartEndE-ValueType
LAG1_DNAbind 12 143 2.3e-90 SMART
BTD 144 293 6e-96 SMART
SCOP:d1a02n1 319 411 4e-29 SMART
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201912
AA Change: I137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143866
Gene: ENSMUSG00000039191
AA Change: I137T

DomainStartEndE-ValueType
LAG1_DNAbind 54 185 2.97e-86 SMART
BTD 186 335 8.01e-92 SMART
SCOP:d1a02n1 361 453 6e-29 SMART
low complexity region 489 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201991
AA Change: I125T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144617
Gene: ENSMUSG00000039191
AA Change: I125T

DomainStartEndE-ValueType
LAG1_DNAbind 42 173 2.3e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Rbpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Rbpj APN 5 53651386 missense probably damaging 1.00
IGL02537:Rbpj APN 5 53642143 missense probably damaging 1.00
R0676:Rbpj UTSW 5 53646048 splice site probably benign
R2372:Rbpj UTSW 5 53642195 splice site probably benign
R3814:Rbpj UTSW 5 53653172 nonsense probably null
R4153:Rbpj UTSW 5 53649447 missense probably damaging 1.00
R5023:Rbpj UTSW 5 53649415 missense probably damaging 1.00
R5240:Rbpj UTSW 5 53649440 missense probably damaging 1.00
R5341:Rbpj UTSW 5 53642083 missense possibly damaging 0.71
R6088:Rbpj UTSW 5 53651368 unclassified probably null
R6885:Rbpj UTSW 5 53653151 missense probably damaging 1.00
R7493:Rbpj UTSW 5 53600934 missense probably benign 0.19
R7653:Rbpj UTSW 5 53590351 start codon destroyed probably null
R7893:Rbpj UTSW 5 53645874 missense probably damaging 1.00
R7976:Rbpj UTSW 5 53645874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATTTGCCGCTGCTGAC -3'
(R):5'- GTCTCACTCAGGTAATGTGAGG -3'

Sequencing Primer
(F):5'- TGACGGCCTCTCGTGAG -3'
(R):5'- CTCACTCAGGTAATGTGAGGATTGG -3'
Posted On2019-11-12