Incidental Mutation 'R7703:Thegl'
ID594111
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77016597 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 149 (I149T)
Ref Sequence ENSEMBL: ENSMUSP00000031161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
AA Change: I149T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248
AA Change: I149T

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
AA Change: I149T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248
AA Change: I149T

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAGGTCTCCGCATCCTTC -3'
(R):5'- TGTCATTAGGGTGTCAATTTCCC -3'

Sequencing Primer
(F):5'- GAGGTCTCCGCATCCTTCAGATC -3'
(R):5'- CCCTTTGGATTCCTTGAAGTATAAAG -3'
Posted On2019-11-12