Incidental Mutation 'R7703:Pcolce'
ID594115
Institutional Source Beutler Lab
Gene Symbol Pcolce
Ensembl Gene ENSMUSG00000029718
Gene Nameprocollagen C-endopeptidase enhancer protein
SynonymsAstt-2, Astt2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137605103-137613784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137605212 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 453 (N453S)
Ref Sequence ENSEMBL: ENSMUSP00000031731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031731] [ENSMUST00000037620] [ENSMUST00000054564] [ENSMUST00000111007] [ENSMUST00000124693] [ENSMUST00000133705] [ENSMUST00000142675] [ENSMUST00000154708] [ENSMUST00000155251] [ENSMUST00000197912]
Predicted Effect probably benign
Transcript: ENSMUST00000031731
AA Change: N453S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031731
Gene: ENSMUSG00000029718
AA Change: N453S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 158 272 3e-46 SMART
low complexity region 299 314 N/A INTRINSIC
low complexity region 323 338 N/A INTRINSIC
C345C 352 458 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037620
SMART Domains Protein: ENSMUSP00000040828
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 133 1.2e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054564
AA Change: N478S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057002
Gene: ENSMUSG00000029718
AA Change: N478S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 183 297 3e-46 SMART
low complexity region 324 339 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
C345C 377 483 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111007
SMART Domains Protein: ENSMUSP00000106636
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 3.5e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133705
SMART Domains Protein: ENSMUSP00000122462
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
SCOP:d1grwa_ 34 74 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142675
SMART Domains Protein: ENSMUSP00000115654
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 18 130 3.79e-43 SMART
CUB 140 214 2.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154708
SMART Domains Protein: ENSMUSP00000116851
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197912
AA Change: N231S
SMART Domains Protein: ENSMUSP00000142608
Gene: ENSMUSG00000029718
AA Change: N231S

DomainStartEndE-ValueType
CUB 1 107 2.2e-36 SMART
C345C 130 236 1.3e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in thickened cortical and trabecular bone and abnormal collagen fibrils in both mineralized and nonmineralized tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Pcolce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Pcolce APN 5 137607476 missense probably damaging 0.98
IGL01566:Pcolce APN 5 137605160 utr 3 prime probably benign
R0157:Pcolce UTSW 5 137610479 unclassified probably null
R1585:Pcolce UTSW 5 137610507 nonsense probably null
R2307:Pcolce UTSW 5 137609094 missense probably damaging 0.99
R2507:Pcolce UTSW 5 137607051 missense possibly damaging 0.93
R3700:Pcolce UTSW 5 137609047 missense probably damaging 0.98
R4011:Pcolce UTSW 5 137605774 missense probably benign 0.00
R4223:Pcolce UTSW 5 137605127 utr 3 prime probably benign
R4983:Pcolce UTSW 5 137605674 intron probably benign
R5141:Pcolce UTSW 5 137605750 missense probably benign 0.05
R5626:Pcolce UTSW 5 137610399 missense probably damaging 0.99
R6223:Pcolce UTSW 5 137605299 missense probably damaging 1.00
R6241:Pcolce UTSW 5 137605234 missense probably benign 0.00
R6643:Pcolce UTSW 5 137608903 missense probably damaging 0.97
R6938:Pcolce UTSW 5 137605616 missense probably benign 0.11
R7583:Pcolce UTSW 5 137607445 missense probably benign 0.01
R7596:Pcolce UTSW 5 137606825 critical splice donor site probably null
R8012:Pcolce UTSW 5 137605195 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCTGAAATCCAAGATGTGCC -3'
(R):5'- GAAGTTGTATGTGCCCTGCAG -3'

Sequencing Primer
(F):5'- TCCAAGATGTGCCTCCCAC -3'
(R):5'- GTCTGACCAAGAAGATGCTTTGAC -3'
Posted On2019-11-12