Incidental Mutation 'R7703:Olfr449'
ID594116
Institutional Source Beutler Lab
Gene Symbol Olfr449
Ensembl Gene ENSMUSG00000049168
Gene Nameolfactory receptor 449
SynonymsGA_x6K02T2P3E9-4722003-4721068, MOR103-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42834384-42839516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42838004 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 41 (E41V)
Ref Sequence ENSEMBL: ENSMUSP00000148895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050729] [ENSMUST00000204072] [ENSMUST00000204229] [ENSMUST00000214687]
Predicted Effect probably damaging
Transcript: ENSMUST00000050729
AA Change: E41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168
AA Change: E41V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204072
AA Change: E41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000204229
AA Change: E41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145055
Gene: ENSMUSG00000049168
AA Change: E41V

DomainStartEndE-ValueType
Pfam:7tm_4 31 130 1.7e-20 PFAM
Pfam:7tm_1 41 130 2.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214687
AA Change: E41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Olfr449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01904:Olfr449 APN 6 42838289 missense possibly damaging 0.76
IGL02193:Olfr449 APN 6 42838819 utr 3 prime probably benign
IGL02496:Olfr449 APN 6 42838804 missense probably benign 0.00
IGL03302:Olfr449 APN 6 42838003 nonsense probably null
IGL03333:Olfr449 APN 6 42838703 missense possibly damaging 0.95
R1340:Olfr449 UTSW 6 42838009 missense probably benign 0.00
R1926:Olfr449 UTSW 6 42838313 missense probably damaging 1.00
R2418:Olfr449 UTSW 6 42838049 missense probably benign 0.03
R4837:Olfr449 UTSW 6 42837849 unclassified probably null
R5466:Olfr449 UTSW 6 42838093 missense probably benign 0.08
R5733:Olfr449 UTSW 6 42838246 missense probably damaging 0.97
R6411:Olfr449 UTSW 6 42838720 missense possibly damaging 0.57
R6626:Olfr449 UTSW 6 42838648 missense probably benign 0.14
R6912:Olfr449 UTSW 6 42838802 missense probably benign
R7278:Olfr449 UTSW 6 42834396 utr 5 prime probably null
R7399:Olfr449 UTSW 6 42838746 nonsense probably null
Z1176:Olfr449 UTSW 6 42837977 missense probably damaging 1.00
Z1177:Olfr449 UTSW 6 42838376 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTACGGACTCTGATCAAGTGATTC -3'
(R):5'- GCAGCTAGGAGAACGCATTC -3'

Sequencing Primer
(F):5'- TCTTTTCTCTCAGAAAGGCTAGG -3'
(R):5'- TGCAATGAAGAAGTAAAGCTGTATC -3'
Posted On2019-11-12