Incidental Mutation 'R7703:Skap2'
ID594117
Institutional Source Beutler Lab
Gene Symbol Skap2
Ensembl Gene ENSMUSG00000059182
Gene Namesrc family associated phosphoprotein 2
SynonymsSaps, RA70, SKAP-HOM, mSKAP55R, 2610021A10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location51857422-52012549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51907954 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 242 (H242Q)
Ref Sequence ENSEMBL: ENSMUSP00000145462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078214] [ENSMUST00000203948] [ENSMUST00000204778]
Predicted Effect probably benign
Transcript: ENSMUST00000078214
AA Change: H235Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077342
Gene: ENSMUSG00000059182
AA Change: H235Q

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203948
SMART Domains Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
Blast:PH 1 49 1e-28 BLAST
PDB:1U5F|A 1 74 1e-30 PDB
SH3 83 126 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204778
AA Change: H242Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145462
Gene: ENSMUSG00000059182
AA Change: H242Q

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal. Homozygotes for a gene-trapped allele show impaired B-cell responses and B-cell adhesion, decreased susceptibility to EAE, abnormal dendritic cell physiology, fast extinction of fear memory, and impaired social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Skap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Skap2 APN 6 51921300 missense probably damaging 1.00
IGL01526:Skap2 APN 6 51907914 missense probably benign 0.20
IGL01543:Skap2 APN 6 52012395 missense possibly damaging 0.88
IGL01879:Skap2 APN 6 51996034 missense possibly damaging 0.90
IGL01893:Skap2 APN 6 51874576 missense probably damaging 1.00
IGL02154:Skap2 APN 6 52012328 splice site probably benign
IGL02406:Skap2 APN 6 51874473 critical splice donor site probably null
IGL02409:Skap2 APN 6 51907958 missense possibly damaging 0.51
IGL02937:Skap2 APN 6 51909371 missense probably benign 0.01
R0648:Skap2 UTSW 6 51879785 missense probably benign 0.05
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R2370:Skap2 UTSW 6 51921330 missense probably damaging 1.00
R3837:Skap2 UTSW 6 51909299 critical splice donor site probably null
R4847:Skap2 UTSW 6 52003669 missense probably benign 0.01
R4939:Skap2 UTSW 6 51922323 missense possibly damaging 0.49
R5555:Skap2 UTSW 6 51860018 missense probably damaging 1.00
Z1176:Skap2 UTSW 6 51921280 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCCACACTTGAAATGTGTC -3'
(R):5'- GGTAGCACGTAGATGACAGTTTTC -3'

Sequencing Primer
(F):5'- GTGTCAAGCAGAAGTCCTTTC -3'
(R):5'- CACGTAGATGACAGTTTTCAGAGTTG -3'
Posted On2019-11-12