Incidental Mutation 'R7703:Tfpt'
ID594118
Institutional Source Beutler Lab
Gene Symbol Tfpt
Ensembl Gene ENSMUSG00000006335
Gene NameTCF3 (E2A) fusion partner
SynonymsAmida, FB1, 2400004F01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3620324-3629929 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 3620745 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039507] [ENSMUST00000076657] [ENSMUST00000108641] [ENSMUST00000108641] [ENSMUST00000108641] [ENSMUST00000108644] [ENSMUST00000108645] [ENSMUST00000148012] [ENSMUST00000148403] [ENSMUST00000153143] [ENSMUST00000155592] [ENSMUST00000205596] [ENSMUST00000206370]
Predicted Effect probably benign
Transcript: ENSMUST00000039507
SMART Domains Protein: ENSMUSP00000041306
Gene: ENSMUSG00000054594

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 43 126 1.03e0 SMART
internal_repeat_1 133 218 3.4e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000058880
SMART Domains Protein: ENSMUSP00000053108
Gene: ENSMUSG00000006335

DomainStartEndE-ValueType
low complexity region 51 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076657
SMART Domains Protein: ENSMUSP00000075953
Gene: ENSMUSG00000035674

DomainStartEndE-ValueType
Pfam:NADHdh_A3 1 84 1.2e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108641
SMART Domains Protein: ENSMUSP00000104281
Gene: ENSMUSG00000006335

DomainStartEndE-ValueType
low complexity region 58 80 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108641
SMART Domains Protein: ENSMUSP00000104281
Gene: ENSMUSG00000006335

DomainStartEndE-ValueType
low complexity region 58 80 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108641
SMART Domains Protein: ENSMUSP00000104281
Gene: ENSMUSG00000006335

DomainStartEndE-ValueType
low complexity region 58 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108644
SMART Domains Protein: ENSMUSP00000104284
Gene: ENSMUSG00000035674

DomainStartEndE-ValueType
Pfam:NADHdh_A3 1 100 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108645
SMART Domains Protein: ENSMUSP00000104285
Gene: ENSMUSG00000054594

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 37 120 1.03e0 SMART
Pfam:Ig_2 128 215 4.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134683
Predicted Effect probably benign
Transcript: ENSMUST00000148012
SMART Domains Protein: ENSMUSP00000123672
Gene: ENSMUSG00000054594

DomainStartEndE-ValueType
IG 26 109 1.03e0 SMART
Pfam:Ig_2 117 204 2.8e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148403
Predicted Effect probably benign
Transcript: ENSMUST00000153143
Predicted Effect probably benign
Transcript: ENSMUST00000155592
SMART Domains Protein: ENSMUSP00000123636
Gene: ENSMUSG00000006335

DomainStartEndE-ValueType
low complexity region 58 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205596
Predicted Effect probably benign
Transcript: ENSMUST00000206370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Tfpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Tfpt APN 7 3629040 missense probably damaging 1.00
IGL02267:Tfpt APN 7 3628983 missense probably damaging 1.00
R0409:Tfpt UTSW 7 3620899 nonsense probably null
R2122:Tfpt UTSW 7 3628931 missense probably damaging 1.00
R4211:Tfpt UTSW 7 3620387 missense probably damaging 1.00
R6194:Tfpt UTSW 7 3629027 missense probably damaging 1.00
R6257:Tfpt UTSW 7 3629567 nonsense probably null
R6659:Tfpt UTSW 7 3620836 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTCACCAATCAGCCTATGGG -3'
(R):5'- AATGCTGAGAATGAACCTCCAG -3'

Sequencing Primer
(F):5'- TGGTTTCCCAGGTTAGACAC -3'
(R):5'- TGCTGAGAATGAACCTCCAGAGAAAG -3'
Posted On2019-11-12