Incidental Mutation 'R7703:Prr36'
ID594121
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Nameproline rich 36
SynonymsBC068157
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location4209543-4217459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4212982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 895 (T895A)
Ref Sequence ENSEMBL: ENSMUSP00000133114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176227] [ENSMUST00000176764] [ENSMUST00000176825] [ENSMUST00000177491]
Predicted Effect probably benign
Transcript: ENSMUST00000168386
AA Change: T895A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: T895A

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175906
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176072
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176149
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176227
Predicted Effect probably benign
Transcript: ENSMUST00000176645
Predicted Effect probably benign
Transcript: ENSMUST00000176764
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176825
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177491
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4216230 missense probably benign 0.01
IGL01535:Prr36 APN 8 4214043 unclassified probably benign
IGL01658:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01710:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01712:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01713:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01892:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01893:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL02496:Prr36 APN 8 4216407 nonsense probably null
IGL02829:Prr36 APN 8 4215278 missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4213930 nonsense probably null
R0667:Prr36 UTSW 8 4216311 unclassified probably benign
R0784:Prr36 UTSW 8 4213771 unclassified probably benign
R1737:Prr36 UTSW 8 4214370 unclassified probably benign
R2017:Prr36 UTSW 8 4215205 missense probably benign 0.02
R2032:Prr36 UTSW 8 4214304 unclassified probably benign
R2430:Prr36 UTSW 8 4213488 unclassified probably benign
R4160:Prr36 UTSW 8 4212910 missense probably benign 0.10
R4184:Prr36 UTSW 8 4213409 unclassified probably benign
R4393:Prr36 UTSW 8 4214901 unclassified probably benign
R4887:Prr36 UTSW 8 4210881 missense probably benign 0.01
R5508:Prr36 UTSW 8 4216488 missense probably damaging 0.99
R5628:Prr36 UTSW 8 4216273 small deletion probably benign
R6189:Prr36 UTSW 8 4214177 unclassified probably benign
R6277:Prr36 UTSW 8 4214746 unclassified probably benign
R7185:Prr36 UTSW 8 4216458 missense probably damaging 1.00
R7286:Prr36 UTSW 8 4215163 critical splice donor site probably benign
R7338:Prr36 UTSW 8 4216212 missense probably damaging 1.00
R7604:Prr36 UTSW 8 4214836 missense unknown
R7621:Prr36 UTSW 8 4213150 missense unknown
R7842:Prr36 UTSW 8 4210953 missense probably benign 0.09
R7853:Prr36 UTSW 8 4213905 missense unknown
R7925:Prr36 UTSW 8 4210953 missense probably benign 0.09
R7936:Prr36 UTSW 8 4213905 missense unknown
RF044:Prr36 UTSW 8 4216273 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAGCAGGGCTTGACAAC -3'
(R):5'- ATACCCTGTCCGCAGACTC -3'

Sequencing Primer
(F):5'- AGCAGGGCTTGACAACTTCTTG -3'
(R):5'- GGTCCAGATGTCCCTATCACAG -3'
Posted On2019-11-12