Incidental Mutation 'R7703:Muc16'
ID594126
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18605282 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 313 (I313M)
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTTCTCACAGGAAAAGGAGTAG -3'
(R):5'- TTCTGTTACAGCCACAAGCCC -3'

Sequencing Primer
(F):5'- TAGAAAGGAGTTTGTGGTCACC -3'
(R):5'- TTTCACTATAACCAACCTGCAGC -3'
Posted On2019-11-12