Incidental Mutation 'R7703:Chrna3'
ID594130
Institutional Source Beutler Lab
Gene Symbol Chrna3
Ensembl Gene ENSMUSG00000032303
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 3
SynonymsA730007P14Rik, Acra3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, alpha 3, (a)3, Acra-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location55010111-55026562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55016124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 133 (D133E)
Ref Sequence ENSEMBL: ENSMUSP00000034851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000214204]
Predicted Effect probably benign
Transcript: ENSMUST00000034851
AA Change: D133E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303
AA Change: D133E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214204
AA Change: D133E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation show high postnatal and postweaning mortality. Mutants show reduced bladder contractility resulting in enlarged bladder, infections and urinary stones. Eyes are small, with dilated ocular pupils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Chrna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Chrna3 APN 9 55016006 missense probably benign 0.01
IGL02484:Chrna3 APN 9 55015537 missense probably damaging 1.00
R0494:Chrna3 UTSW 9 55022278 missense probably damaging 1.00
R0538:Chrna3 UTSW 9 55016006 missense probably benign 0.01
R0557:Chrna3 UTSW 9 55015865 missense probably damaging 1.00
R0674:Chrna3 UTSW 9 55015172 missense probably damaging 1.00
R1552:Chrna3 UTSW 9 55015908 missense probably benign 0.16
R1750:Chrna3 UTSW 9 55016057 missense probably damaging 1.00
R2191:Chrna3 UTSW 9 55016045 missense probably damaging 1.00
R2989:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3114:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3153:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3154:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3434:Chrna3 UTSW 9 55024326 missense possibly damaging 0.95
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3733:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R4758:Chrna3 UTSW 9 55022276 missense probably damaging 1.00
R4903:Chrna3 UTSW 9 55015526 missense probably benign 0.01
R5430:Chrna3 UTSW 9 55012908 missense probably damaging 0.98
R5795:Chrna3 UTSW 9 55015268 missense probably benign 0.17
R6546:Chrna3 UTSW 9 55015901 missense probably damaging 1.00
R6806:Chrna3 UTSW 9 55015810 missense probably damaging 1.00
R7516:Chrna3 UTSW 9 55015369 missense probably benign 0.00
R8053:Chrna3 UTSW 9 55015390 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AATGAGGACCAGGTCGATCTTTG -3'
(R):5'- CCAATGTGGGTGAGCATTGC -3'

Sequencing Primer
(F):5'- TGCCTTGTCGTAGGACCAG -3'
(R):5'- GCCTCAGTATCTTCACTGGAGAATG -3'
Posted On2019-11-12