Incidental Mutation 'R7703:Kcnh6'
ID594142
Institutional Source Beutler Lab
Gene Symbol Kcnh6
Ensembl Gene ENSMUSG00000001901
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 6
Synonymsm-erg2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7703 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106008124-106034549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106023877 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 703 (T703S)
Ref Sequence ENSEMBL: ENSMUSP00000001965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
AA Change: T703S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: T703S

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106903
AA Change: T650S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: T650S

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
AA Change: T703S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: T703S

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Diaph1 T C 18: 37,890,809 I659V unknown Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Kcnh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnh6 APN 11 106019019 missense probably damaging 1.00
IGL01349:Kcnh6 APN 11 106023917 missense possibly damaging 0.82
IGL01529:Kcnh6 APN 11 106020696 missense probably benign 0.07
IGL01555:Kcnh6 APN 11 106017619 missense probably damaging 0.99
IGL01596:Kcnh6 APN 11 106026746 missense probably benign 0.02
IGL01808:Kcnh6 APN 11 106023927 splice site probably benign
IGL02001:Kcnh6 APN 11 106027549 splice site probably benign
IGL02131:Kcnh6 APN 11 106020175 missense probably damaging 1.00
IGL02254:Kcnh6 APN 11 106020707 missense probably damaging 1.00
IGL02413:Kcnh6 APN 11 106027634 missense possibly damaging 0.77
R0089:Kcnh6 UTSW 11 106009022 missense probably benign 0.31
R1914:Kcnh6 UTSW 11 106017444 nonsense probably null
R1915:Kcnh6 UTSW 11 106017444 nonsense probably null
R2265:Kcnh6 UTSW 11 106033817 missense probably benign
R2325:Kcnh6 UTSW 11 106033835 missense probably benign 0.00
R4449:Kcnh6 UTSW 11 106018936 missense probably damaging 0.99
R4548:Kcnh6 UTSW 11 106009049 missense probably damaging 1.00
R5095:Kcnh6 UTSW 11 106017254 missense possibly damaging 0.92
R5166:Kcnh6 UTSW 11 106020319 missense possibly damaging 0.67
R5358:Kcnh6 UTSW 11 106027591 missense possibly damaging 0.93
R5445:Kcnh6 UTSW 11 106023859 missense probably damaging 1.00
R5652:Kcnh6 UTSW 11 106008985 missense probably damaging 1.00
R5708:Kcnh6 UTSW 11 106020256 missense probably benign 0.04
R5742:Kcnh6 UTSW 11 106009142 missense probably benign 0.32
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6150:Kcnh6 UTSW 11 106020731 missense possibly damaging 0.83
R6827:Kcnh6 UTSW 11 106009099 missense probably benign 0.05
R7172:Kcnh6 UTSW 11 106020274 missense possibly damaging 0.86
R7329:Kcnh6 UTSW 11 106017377 missense probably benign 0.29
R7359:Kcnh6 UTSW 11 106018963 missense possibly damaging 0.46
R7542:Kcnh6 UTSW 11 106014561 missense possibly damaging 0.68
R7571:Kcnh6 UTSW 11 106017416 missense probably benign 0.01
R7580:Kcnh6 UTSW 11 106017548 missense probably damaging 1.00
R7726:Kcnh6 UTSW 11 106017575 missense probably benign 0.04
R7837:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7854:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
R7920:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7937:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
X0065:Kcnh6 UTSW 11 106025795 missense probably benign
Z1088:Kcnh6 UTSW 11 106009048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCACAGTCAATGGGGCC -3'
(R):5'- TACAGAAGTATCCCAGCAAAGG -3'

Sequencing Primer
(F):5'- CCCCGAGAGAAGGTCTTCATAAG -3'
(R):5'- CAAAGGATGCACGAGGAGTTG -3'
Posted On2019-11-12