Incidental Mutation 'R7703:Diaph1'
ID594157
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Namediaphanous related formin 1
SynonymsDrf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7703 (G1)
Quality Score92.0077
Status Not validated
Chromosome18
Chromosomal Location37843601-37935476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37890809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 659 (I659V)
Ref Sequence ENSEMBL: ENSMUSP00000078942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
Predicted Effect unknown
Transcript: ENSMUST00000025337
AA Change: I668V
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: I668V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000080033
AA Change: I659V
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: I659V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115629
AA Change: I624V
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: I624V

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115631
AA Change: I624V
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: I624V

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115634
AA Change: I659V
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: I659V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,425,767 I191T probably damaging Het
2310003L06Rik T C 5: 87,972,812 L476P possibly damaging Het
Aasdh T C 5: 76,888,077 D387G probably damaging Het
Ahsa2 T A 11: 23,490,415 T327S probably benign Het
Ap3d1 A T 10: 80,717,844 V523E probably damaging Het
Baz2b C A 2: 59,917,425 R1298L probably damaging Het
Cacna2d3 T C 14: 29,043,546 T802A possibly damaging Het
Cdh23 G T 10: 60,337,264 T1714K probably damaging Het
Chrna3 A T 9: 55,016,124 D133E probably benign Het
Cnot1 C T 8: 95,760,098 probably null Het
Col16a1 A T 4: 130,096,502 N1396Y unknown Het
Cox11 A G 11: 90,638,419 N77S probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip A G 2: 58,147,908 V148A probably damaging Het
Dmxl2 A T 9: 54,461,086 M26K probably benign Het
Erp44 T A 4: 48,196,904 I340F probably benign Het
Fam186a A G 15: 99,954,797 M180T unknown Het
Frem2 C T 3: 53,522,168 V2793I probably benign Het
Gm19410 A G 8: 35,799,385 E1064G probably damaging Het
Gria4 T C 9: 4,503,588 I343V probably benign Het
Grsf1 T A 5: 88,671,291 N228Y probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ighv1-18 A T 12: 114,682,761 N74K probably benign Het
Kcnh6 A T 11: 106,023,877 T703S probably benign Het
Lrp1b T A 2: 41,110,786 D2256V Het
Lrrc63 T C 14: 75,123,007 T352A possibly damaging Het
Lztfl1 T C 9: 123,702,129 E258G probably damaging Het
Mcph1 T C 8: 18,671,106 I650T possibly damaging Het
Mep1a T C 17: 43,478,106 D606G possibly damaging Het
Muc16 T C 9: 18,605,282 I313M Het
Myh7b A G 2: 155,620,436 Y353C probably null Het
Nfatc1 A G 18: 80,682,289 L420P probably damaging Het
Olfml1 A G 7: 107,571,185 E93G probably damaging Het
Olfr251 A G 9: 38,378,061 H54R probably benign Het
Olfr449 A T 6: 42,838,004 E41V probably damaging Het
Pax1 A T 2: 147,366,114 N214I probably damaging Het
Pcdhb17 C A 18: 37,486,748 H530Q probably benign Het
Pcdhgb7 A T 18: 37,752,268 M164L probably benign Het
Pcolce T C 5: 137,605,212 N453S probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Ptprq C T 10: 107,644,146 V1088I probably benign Het
Rab5a T A 17: 53,500,457 F174I probably damaging Het
Rapgef4 A G 2: 72,179,971 D291G probably benign Het
Rbm25 A T 12: 83,675,090 K683N possibly damaging Het
Rbpj T C 5: 53,645,898 I156T probably damaging Het
Rgsl1 A G 1: 153,793,864 S259P possibly damaging Het
Ring1 T C 17: 34,023,135 D100G probably damaging Het
Ryr3 A T 2: 112,859,765 D1166E probably damaging Het
Sacs A G 14: 61,206,090 K1862E possibly damaging Het
Scamp5 A G 9: 57,447,182 I63T possibly damaging Het
Sept14 C T 5: 129,686,028 A334T possibly damaging Het
Sh3rf2 A T 18: 42,156,136 Q706L probably benign Het
Skap2 A T 6: 51,907,954 H242Q probably benign Het
Tfpt A G 7: 3,620,745 probably null Het
Thegl T C 5: 77,016,597 I149T probably benign Het
Thg1l T G 11: 45,955,293 D58A probably damaging Het
Thyn1 A G 9: 27,006,847 E177G probably benign Het
Tmem151b C T 17: 45,545,798 A239T probably damaging Het
Ttc21a T C 9: 119,959,029 V840A probably benign Het
Usp32 A T 11: 85,077,327 V170E probably damaging Het
Vmn2r29 A G 7: 7,231,865 V674A probably benign Het
Vwa8 A G 14: 79,026,073 N781S probably damaging Het
Zbtb7c C A 18: 76,137,362 Q174K probably benign Het
Zeb1 T C 18: 5,766,917 I476T probably benign Het
Zfp91 A T 19: 12,776,877 D282E probably benign Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
fishnets UTSW 18 37895300 critical splice acceptor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 intron probably null
R7834:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R7917:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R8073:Diaph1 UTSW 18 37891797 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAAATGGCAGAACTGGGG -3'
(R):5'- GGTGACTCTGGCACTGTTATTCC -3'

Sequencing Primer
(F):5'- AGGAATGCCAGGTGCTCCAG -3'
(R):5'- TGGAGGTGTGGTCCCAC -3'
Posted On2019-11-12