Mutagenetix > Incidental Mutations

Incidental Mutation 'R7703:Ctsf'

594161

Institutional Source

Beutler Lab

Gene Symbol

Ctsf

Ensembl Gene

ENSMUSG00000083282

Gene Name

cathepsin F

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R7703 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4855129-4860912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4856539 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 165 (F165V)

Ref Sequence

ENSEMBL: ENSMUSP00000112481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]

Predicted Effect

probably benign
Transcript: ENSMUST00000006626

SMART Domains

Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CH	46	146	1.4e-23	SMART
CH	159	258	4.83e-27	SMART
low complexity region	261	272	N/A	INTRINSIC
Pfam:Spectrin	287	397	5.5e-15	PFAM
SPEC	410	511	3.78e-23	SMART
SPEC	525	632	2.37e-6	SMART
Pfam:Spectrin	643	746	4.1e-15	PFAM
EFh	763	791	7.93e-1	SMART
EFh	799	827	5.96e-1	SMART
efhand_Ca_insen	830	896	2.29e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
Inhibitor_I29	165	222	5.41e-16	SMART
Pept_C1	249	460	4.2e-93	SMART

Meta Mutation Damage Score

0.8977

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	C	11: 58,425,767	I191T	probably damaging	Het
2310003L06Rik	T	C	5: 87,972,812	L476P	possibly damaging	Het
Aasdh	T	C	5: 76,888,077	D387G	probably damaging	Het
Ahsa2	T	A	11: 23,490,415	T327S	probably benign	Het
Ap3d1	A	T	10: 80,717,844	V523E	probably damaging	Het
Baz2b	C	A	2: 59,917,425	R1298L	probably damaging	Het
Cacna2d3	T	C	14: 29,043,546	T802A	possibly damaging	Het
Cdh23	G	T	10: 60,337,264	T1714K	probably damaging	Het
Chrna3	A	T	9: 55,016,124	D133E	probably benign	Het
Cnot1	C	T	8: 95,760,098		probably null	Het
Col16a1	A	T	4: 130,096,502	N1396Y	unknown	Het
Cox11	A	G	11: 90,638,419	N77S	probably benign	Het
Cytip	A	G	2: 58,147,908	V148A	probably damaging	Het
Diaph1	T	C	18: 37,890,809	I659V	unknown	Het
Dmxl2	A	T	9: 54,461,086	M26K	probably benign	Het
Erp44	T	A	4: 48,196,904	I340F	probably benign	Het
Fam186a	A	G	15: 99,954,797	M180T	unknown	Het
Frem2	C	T	3: 53,522,168	V2793I	probably benign	Het
Gm19410	A	G	8: 35,799,385	E1064G	probably damaging	Het
Gria4	T	C	9: 4,503,588	I343V	probably benign	Het
Grsf1	T	A	5: 88,671,291	N228Y	probably damaging	Het
Hist2h3b	C	A	3: 96,268,993	Y100*	probably null	Het
Ighv1-18	A	T	12: 114,682,761	N74K	probably benign	Het
Kcnh6	A	T	11: 106,023,877	T703S	probably benign	Het
Lrp1b	T	A	2: 41,110,786	D2256V		Het
Lrrc63	T	C	14: 75,123,007	T352A	possibly damaging	Het
Lztfl1	T	C	9: 123,702,129	E258G	probably damaging	Het
Mcph1	T	C	8: 18,671,106	I650T	possibly damaging	Het
Mep1a	T	C	17: 43,478,106	D606G	possibly damaging	Het
Muc16	T	C	9: 18,605,282	I313M		Het
Myh7b	A	G	2: 155,620,436	Y353C	probably null	Het
Nfatc1	A	G	18: 80,682,289	L420P	probably damaging	Het
Olfml1	A	G	7: 107,571,185	E93G	probably damaging	Het
Olfr251	A	G	9: 38,378,061	H54R	probably benign	Het
Olfr449	A	T	6: 42,838,004	E41V	probably damaging	Het
Pax1	A	T	2: 147,366,114	N214I	probably damaging	Het
Pcdhb17	C	A	18: 37,486,748	H530Q	probably benign	Het
Pcdhgb7	A	T	18: 37,752,268	M164L	probably benign	Het
Pcolce	T	C	5: 137,605,212	N453S	probably benign	Het
Prr36	T	C	8: 4,212,982	T895A	probably benign	Het
Ptprq	C	T	10: 107,644,146	V1088I	probably benign	Het
Rab5a	T	A	17: 53,500,457	F174I	probably damaging	Het
Rapgef4	A	G	2: 72,179,971	D291G	probably benign	Het
Rbm25	A	T	12: 83,675,090	K683N	possibly damaging	Het
Rbpj	T	C	5: 53,645,898	I156T	probably damaging	Het
Rgsl1	A	G	1: 153,793,864	S259P	possibly damaging	Het
Ring1	T	C	17: 34,023,135	D100G	probably damaging	Het
Ryr3	A	T	2: 112,859,765	D1166E	probably damaging	Het
Sacs	A	G	14: 61,206,090	K1862E	possibly damaging	Het
Scamp5	A	G	9: 57,447,182	I63T	possibly damaging	Het
Sept14	C	T	5: 129,686,028	A334T	possibly damaging	Het
Sh3rf2	A	T	18: 42,156,136	Q706L	probably benign	Het
Skap2	A	T	6: 51,907,954	H242Q	probably benign	Het
Tfpt	A	G	7: 3,620,745		probably null	Het
Thegl	T	C	5: 77,016,597	I149T	probably benign	Het
Thg1l	T	G	11: 45,955,293	D58A	probably damaging	Het
Thyn1	A	G	9: 27,006,847	E177G	probably benign	Het
Tmem151b	C	T	17: 45,545,798	A239T	probably damaging	Het
Ttc21a	T	C	9: 119,959,029	V840A	probably benign	Het
Usp32	A	T	11: 85,077,327	V170E	probably damaging	Het
Vmn2r29	A	G	7: 7,231,865	V674A	probably benign	Het
Vwa8	A	G	14: 79,026,073	N781S	probably damaging	Het
Zbtb7c	C	A	18: 76,137,362	Q174K	probably benign	Het
Zeb1	T	C	18: 5,766,917	I476T	probably benign	Het
Zfp91	A	T	19: 12,776,877	D282E	probably benign	Het

Other mutations in Ctsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01631:Ctsf	APN	19	4858078	missense	probably damaging	1.00
IGL01891:Ctsf	APN	19	4856567	missense	probably damaging	0.99
IGL03291:Ctsf	APN	19	4859634	missense	probably benign	0.00
R0587:Ctsf	UTSW	19	4855738	missense	probably benign	0.35
R0831:Ctsf	UTSW	19	4859840	missense	possibly damaging	0.92
R1808:Ctsf	UTSW	19	4856534	missense	probably benign	0.00
R5652:Ctsf	UTSW	19	4858477	missense	probably damaging	1.00
R5662:Ctsf	UTSW	19	4856578	missense	probably damaging	0.98
R6993:Ctsf	UTSW	19	4858483	missense	probably benign	0.45
R7702:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7704:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7705:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7962:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7965:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7966:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
RF012:Ctsf	UTSW	19	4858666	missense	probably benign	0.05
Z1176:Ctsf	UTSW	19	4856306	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGAGACAAAGGCCCCTTAATC -3'
(R):5'- TCCTTGAGAGACACAGGATCC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'

Posted On

2019-11-12