Incidental Mutation 'R7704:Zap70'
ID 594164
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Name zeta-chain (TCR) associated protein kinase
Synonyms ZAP-70, TZK, Srk
MMRRC Submission 045765-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.322) question?
Stock # R7704 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 36800879-36821899 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 36818395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
AlphaFold P43404
Predicted Effect probably null
Transcript: ENSMUST00000027291
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,756,068 (GRCm39) W1458L probably damaging Het
Actn4 A T 7: 28,596,467 (GRCm39) I676N possibly damaging Het
Adamts10 T C 17: 33,770,126 (GRCm39) C1002R probably damaging Het
Agbl2 A C 2: 90,619,349 (GRCm39) N58T probably benign Het
Akap12 A T 10: 4,306,082 (GRCm39) D1069V probably damaging Het
Bltp2 C A 11: 78,159,570 (GRCm39) Q540K probably benign Het
Cfap65 T A 1: 74,967,527 (GRCm39) T184S probably benign Het
Chd1 T C 17: 15,987,737 (GRCm39) V1517A probably benign Het
CN725425 T A 15: 91,119,993 (GRCm39) V38D possibly damaging Het
Copg1 T A 6: 87,884,940 (GRCm39) L712Q probably benign Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Ddx21 T C 10: 62,429,865 (GRCm39) Y293C probably damaging Het
Ddx46 C T 13: 55,821,832 (GRCm39) P839S probably benign Het
Dennd5a A G 7: 109,496,174 (GRCm39) V1164A possibly damaging Het
Dync1h1 T A 12: 110,632,200 (GRCm39) I4490N probably damaging Het
Ecm1 A C 3: 95,643,843 (GRCm39) Y236D probably damaging Het
Fat2 T C 11: 55,175,173 (GRCm39) T1847A probably benign Het
Galc T A 12: 98,175,102 (GRCm39) I567L probably benign Het
Gask1a C T 9: 121,780,151 (GRCm39) probably benign Het
H6pd T C 4: 150,067,360 (GRCm39) D350G probably benign Het
Ifi44 A G 3: 151,438,061 (GRCm39) Y409H probably benign Het
Kdm5a T G 6: 120,404,025 (GRCm39) F1210C probably damaging Het
Kdm5b C T 1: 134,515,669 (GRCm39) R98C probably damaging Het
Lipt1 T A 1: 37,915,043 (GRCm39) C366* probably null Het
Med13 G A 11: 86,236,744 (GRCm39) R138* probably null Het
Mterf1a A G 5: 3,941,845 (GRCm39) C8R probably benign Het
Ncapg2 A T 12: 116,382,897 (GRCm39) I243F probably damaging Het
Nop58 T C 1: 59,744,754 (GRCm39) S304P probably damaging Het
Nsd2 T C 5: 34,028,811 (GRCm39) *167Q probably null Het
Or1e30 T G 11: 73,678,616 (GRCm39) M284R probably damaging Het
Or2t35 T A 14: 14,407,867 (GRCm38) I213N probably damaging Het
Or52ab2 T A 7: 102,969,978 (GRCm39) M120K Het
Pramel29 C T 4: 143,935,091 (GRCm39) V217I possibly damaging Het
Prdm16 C T 4: 154,425,947 (GRCm39) G613R probably damaging Het
Prss46 T C 9: 110,679,065 (GRCm39) S89P probably damaging Het
Scin T C 12: 40,174,687 (GRCm39) N132S possibly damaging Het
Sec14l2 T C 11: 4,058,574 (GRCm39) K196R probably benign Het
Sox17 C A 1: 4,563,895 (GRCm39) probably benign Het
Tango6 A G 8: 107,425,621 (GRCm39) T394A probably benign Het
Tbc1d22a T A 15: 86,250,876 (GRCm39) I398N probably damaging Het
Tdpoz8 A G 3: 92,981,752 (GRCm39) I183V probably benign Het
Tmem8b T C 4: 43,689,461 (GRCm39) V285A probably damaging Het
Tnfrsf11b T A 15: 54,123,497 (GRCm39) T35S probably benign Het
Unc13c T A 9: 73,606,494 (GRCm39) I1289F probably benign Het
Ust C T 10: 8,205,987 (GRCm39) V99I probably benign Het
Vmn1r76 A G 7: 11,664,344 (GRCm39) V290A probably benign Het
Vmn2r50 T C 7: 9,781,665 (GRCm39) N360S probably benign Het
Vmn2r93 T C 17: 18,536,910 (GRCm39) I531T probably benign Het
Zfp932 A G 5: 110,157,630 (GRCm39) N443D probably benign Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36,820,230 (GRCm39) missense probably damaging 1.00
murdock APN 1 36,818,785 (GRCm39) missense probably damaging 0.99
IGL00763:Zap70 APN 1 36,818,333 (GRCm39) missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36,810,238 (GRCm39) missense probably damaging 0.99
IGL01918:Zap70 APN 1 36,817,868 (GRCm39) missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36,810,267 (GRCm39) missense probably damaging 0.99
IGL02502:Zap70 APN 1 36,817,887 (GRCm39) splice site probably benign
IGL02597:Zap70 APN 1 36,811,001 (GRCm39) nonsense probably null
IGL03026:Zap70 APN 1 36,818,798 (GRCm39) missense possibly damaging 0.94
biscayne UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
mesa_verde UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
shazzam UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
trebia UTSW 1 36,820,106 (GRCm39) missense probably damaging 1.00
wanna UTSW 1 36,810,064 (GRCm39) missense probably damaging 1.00
wanna2 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
wanna3 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
wanna4 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
want_to UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
waterfowl UTSW 1 36,809,892 (GRCm39) start codon destroyed probably null 0.03
zapatos UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
zipper UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36,818,250 (GRCm39) missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36,818,365 (GRCm39) missense probably damaging 1.00
R0701:Zap70 UTSW 1 36,820,258 (GRCm39) missense probably damaging 1.00
R0960:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R1520:Zap70 UTSW 1 36,810,036 (GRCm39) missense probably damaging 1.00
R2064:Zap70 UTSW 1 36,818,215 (GRCm39) missense probably benign
R3623:Zap70 UTSW 1 36,818,216 (GRCm39) missense probably benign 0.03
R3689:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3690:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3804:Zap70 UTSW 1 36,810,223 (GRCm39) missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36,817,498 (GRCm39) missense probably damaging 1.00
R4260:Zap70 UTSW 1 36,818,189 (GRCm39) splice site probably benign
R4383:Zap70 UTSW 1 36,820,042 (GRCm39) missense probably damaging 1.00
R4632:Zap70 UTSW 1 36,817,539 (GRCm39) missense probably benign
R4783:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R5051:Zap70 UTSW 1 36,820,532 (GRCm39) missense probably benign 0.00
R5271:Zap70 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
R5304:Zap70 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
R5792:Zap70 UTSW 1 36,818,090 (GRCm39) intron probably benign
R5932:Zap70 UTSW 1 36,820,227 (GRCm39) missense probably damaging 1.00
R5941:Zap70 UTSW 1 36,810,030 (GRCm39) missense probably damaging 1.00
R6694:Zap70 UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
R6825:Zap70 UTSW 1 36,817,471 (GRCm39) missense probably damaging 1.00
R7039:Zap70 UTSW 1 36,817,832 (GRCm39) missense probably benign
R7769:Zap70 UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
R8115:Zap70 UTSW 1 36,820,287 (GRCm39) missense probably damaging 1.00
R8140:Zap70 UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
R9186:Zap70 UTSW 1 36,818,832 (GRCm39) missense possibly damaging 0.66
R9540:Zap70 UTSW 1 36,817,869 (GRCm39) missense possibly damaging 0.95
R9654:Zap70 UTSW 1 36,818,327 (GRCm39) missense probably benign 0.03
R9674:Zap70 UTSW 1 36,810,150 (GRCm39) missense probably benign 0.10
S24628:Zap70 UTSW 1 36,809,892 (GRCm39) start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36,818,257 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACACCCGTATGTATACCCAGC -3'
(R):5'- AGTCAGAGACACCTTCCCAG -3'

Sequencing Primer
(F):5'- GTATGTATACCCAGCACGCTTAG -3'
(R):5'- AGACACCTTCCCAGGGAGTG -3'
Posted On 2019-11-12