Incidental Mutation 'R7704:Cfap65'
ID594167
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74928368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 184 (T184S)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T184S

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T184S

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
Akap12 A T 10: 4,356,082 D1069V probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx21 T C 10: 62,594,086 Y293C probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Ifi44 A G 3: 151,732,424 Y409H probably benign Het
Kdm5a T G 6: 120,427,064 F1210C probably damaging Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCAGGTGAAGAAGGTG -3'
(R):5'- AAGTGGAATGTCCTGACTCTTACC -3'

Sequencing Primer
(F):5'- TGAAGAAGGTGGGCAGGTCC -3'
(R):5'- GGAATGTCCTGACTCTTACCTGAAC -3'
Posted On2019-11-12