Incidental Mutation 'R7704:Cfap65'
ID594167
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74928368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 184 (T184S)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T184S

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T184S

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
Akap12 A T 10: 4,356,082 D1069V probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx21 T C 10: 62,594,086 Y293C probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Ifi44 A G 3: 151,732,424 Y409H probably benign Het
Kdm5a T G 6: 120,427,064 F1210C probably damaging Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCAGGTGAAGAAGGTG -3'
(R):5'- AAGTGGAATGTCCTGACTCTTACC -3'

Sequencing Primer
(F):5'- TGAAGAAGGTGGGCAGGTCC -3'
(R):5'- GGAATGTCCTGACTCTTACCTGAAC -3'
Posted On2019-11-12